G1499822



Basic Information


Item Value
gene id G1499822
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 85504836 ~ 85505044 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1714711
accgtgaagcacgggggtggcagcatcatgttgtgggggtgctttgctgcaggagggactggtgcacttcacaaaatagacggcagcatgagggaggaaaattatgtggatatattgaagcaacatctcaagacataagtcaggaagttaaagcttggttgcaaatgggtcttccaaatggataatgaccccaagtatacttccaaagt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1714711 True 209 lncRNA 0.46 1 85504836 85505044

Neighbor


gene id symbol gene type direction distance location
LOC110494775 LOC106566119 coding downstream 79442 85344521 ~ 85425394 (-)
shmt2 shmt2 coding downstream 162170 85300306 ~ 85342666 (-)
LOC118940505 NA coding downstream 178124 85325153 ~ 85326712 (-)
LOC110487407 NA coding downstream 185983 85316345 ~ 85318853 (-)
LOC118940503 NA coding downstream 300161 85190797 ~ 85204675 (-)
LOC110494776 LOC106566127 coding upstream 205157 85710201 ~ 85713130 (-)
LOC110493286 LOC106566136 coding upstream 613531 86118575 ~ 86183605 (-)
LOC110494779 ddit3 coding upstream 731510 86236554 ~ 86242991 (-)
dctn2 LOC106566142 coding upstream 744188 86249232 ~ 86276059 (-)
igsf8 igsf8 coding upstream 1035755 86540799 ~ 86555989 (-)
G1499781 NA non-coding downstream 29346 85475240 ~ 85475490 (-)
G1499743 NA non-coding downstream 101436 85403022 ~ 85403400 (-)
G1499737 NA non-coding downstream 107068 85395918 ~ 85397768 (-)
G1499721 NA non-coding downstream 128561 85343568 ~ 85376275 (-)
G1499711 NA non-coding downstream 222073 85281851 ~ 85282763 (-)
G1499852 NA non-coding upstream 33418 85538462 ~ 85538662 (-)
G1500504 NA non-coding upstream 164603 85669647 ~ 85751343 (-)
G1500513 NA non-coding upstream 172285 85677329 ~ 85682322 (-)
G1500517 NA non-coding upstream 177631 85682675 ~ 85683104 (-)
G1500533 NA non-coding upstream 216567 85721611 ~ 85767996 (-)
G1499684 NA other downstream 216719 85251788 ~ 85288117 (-)
G1499671 NA other downstream 281717 85221125 ~ 85223119 (-)
G1498522 NA other downstream 1447444 84051010 ~ 84057392 (-)
G1498442 NA other downstream 1521942 83982341 ~ 83982894 (-)
G1498077 NA other downstream 1899083 83605243 ~ 83605753 (-)
G1500834 LOC106566150 other upstream 944635 86449679 ~ 86450734 (-)
LOC110493290 map3k12 other upstream 1293021 86798065 ~ 86880836 (-)
G1501650 LOC106566166 other upstream 1629014 87134058 ~ 87166800 (-)
G1501745 NA other upstream 1889736 87394780 ~ 87395835 (-)

Expression


G1499822 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1499822 Expression in each Bioproject

Bar chart with 20 bars.
G1499822 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network