G1500918



Basic Information


Item Value
gene id G1500918
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 86675632 ~ 86676110 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1716066
gttagtaatgagactatatacaggggtacaggttagtaatgagactatatacagggggtacaggttagtaatgagactatatacagggggtacaggttagtaatgagactatatacagggggtacaggttagtaatgagactatatacagggagagccagtaccgagtcaatgtgcaggggtacaggttagtaatgagactatatacaggggtaccaagtcaatgtgcaggttagtaatgagactatatacagggggtaccaagtcaatgtgcaggggtacaggttagtaatgagactatatacagggggtaccggtaccgagtcaatgtgcaggggtacaggtta

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1716066 True 346 lncRNA 0.44 2 86675632 86676110

Neighbor


gene id symbol gene type direction distance location
sp7 sp7 coding downstream 65051 86605940 ~ 86610581 (-)
igsf8 igsf8 coding downstream 119643 86540799 ~ 86555989 (-)
dctn2 LOC106566142 coding downstream 399573 86249232 ~ 86276059 (-)
LOC110494779 ddit3 coding downstream 432641 86236554 ~ 86242991 (-)
LOC110493286 LOC106566136 coding downstream 492027 86118575 ~ 86183605 (-)
LOC110495202 LOC106566175 coding upstream 35343 86711453 ~ 86714926 (-)
LOC110494797 LOC106596199 coding upstream 64438 86740548 ~ 86774465 (-)
LOC110493290 map3k12 coding upstream 124843 86798065 ~ 86880836 (-)
col2a1b LOC106566180 coding upstream 274100 86950210 ~ 87034105 (-)
LOC110494790 ppp1r1a coding upstream 584383 87260493 ~ 87296463 (-)
G1500913 NA non-coding downstream 2279 86671547 ~ 86673353 (-)
G1500889 NA non-coding downstream 60276 86613680 ~ 86615356 (-)
G1500879 NA non-coding downstream 95952 86575582 ~ 86579680 (-)
G1500866 NA non-coding downstream 131645 86543287 ~ 86543987 (-)
G1500840 NA non-coding downstream 138516 86536234 ~ 86537116 (-)
G1500930 NA non-coding upstream 17766 86693876 ~ 86694307 (-)
G1500941 NA non-coding upstream 27279 86703389 ~ 86781368 (-)
G1500911 sp1 non-coding upstream 32585 86708695 ~ 86711199 (-)
G1500958 NA non-coding upstream 56560 86732670 ~ 86733096 (-)
G1500943 NA non-coding upstream 112418 86788528 ~ 86790791 (-)
G1500834 LOC106566150 other downstream 224898 86449679 ~ 86450734 (-)
G1499684 NA other downstream 1387515 85251788 ~ 85288117 (-)
G1499671 NA other downstream 1452513 85221125 ~ 85223119 (-)
G1498522 NA other downstream 2618240 84051010 ~ 84057392 (-)
G1501650 LOC106566166 other upstream 457948 87134058 ~ 87166800 (-)
G1501745 NA other upstream 718670 87394780 ~ 87395835 (-)
dnsl3 dnsl3 other upstream 1486168 88162116 ~ 88175346 (-)
G1502489 NA other upstream 1682042 88358152 ~ 88425505 (-)

Expression


G1500918 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1500918 Expression in each Bioproject

Bar chart with 18 bars.
G1500918 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network