G1501543



Basic Information


Item Value
gene id G1501543
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 88098881 ~ 88102358 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1716791
tctctgtgatatctaggtctatactctctatgatgtctaggtctatactctctatgatctctaggtctatactctctatgatctctaggtctatactctctatgatctctaggtctatactctctatgatgtctaggtctatactctctatgatctctaggtctatactctctatgatctctaggtctatactctgtgatatctaggtctatactctctatgatgtctaggtctatactctctatgatctctaggtctatactctctatgatctctaggtctatactctctgtgatatctaggtctatactctctatgatctctaggtctatac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1716791 True 334 lncRNA 0.37 3 88098881 88102358

Neighbor


gene id symbol gene type direction distance location
LOC110494817 LOC100136539 coding upstream 18925 88074395 ~ 88079956 (+)
LOC110493298 LOC106566194 coding upstream 24943 88035364 ~ 88073938 (+)
LOC118940111 NA coding upstream 69079 88027596 ~ 88031324 (+)
LOC110493299 LOC106566196 coding upstream 82717 87556796 ~ 88016164 (+)
LOC110494786 LOC106566159 coding upstream 583703 87508909 ~ 87515178 (+)
LOC110494814 LOC106566185 coding downstream 81370 88183728 ~ 88186192 (+)
LOC110493296 mcm2 coding downstream 83996 88186354 ~ 88200745 (+)
LOC110493295 LOC106566198 coding downstream 101539 88203897 ~ 88233393 (+)
LOC110493294 LOC106566182 coding downstream 269720 88372078 ~ 88421226 (+)
LOC118940509 NA coding downstream 331990 88434348 ~ 88435516 (+)
G1501536 NA non-coding upstream 15180 88083490 ~ 88083701 (+)
G1501527 NA non-coding upstream 44241 88054209 ~ 88054640 (+)
G1501513 NA non-coding upstream 71584 88027047 ~ 88027297 (+)
G1501600 NA non-coding downstream 120656 88223014 ~ 88223747 (+)
G1501604 LOC101154678 non-coding downstream 145519 88247877 ~ 88248186 (+)
G1501611 NA non-coding downstream 158810 88261168 ~ 88261471 (+)
G1501585 NA non-coding downstream 181611 88283969 ~ 88292911 (+)
LOC110494789 bloc1s1 other upstream 611991 87415720 ~ 87486890 (+)
G1501148 NA other upstream 929874 87168539 ~ 87169007 (+)
G1500170 LOC106566147 other upstream 1571851 86520830 ~ 86527030 (+)
G1500239 NA other upstream 1715336 86382298 ~ 86383545 (+)
G1500198 NA other upstream 1830706 86267328 ~ 86268175 (+)
G1502352 NA other downstream 667512 88769870 ~ 88800640 (+)
G1502370 NA other downstream 704620 88806978 ~ 88808969 (+)
LOC110493303 LOC106566213 other downstream 1003813 89106147 ~ 89150807 (+)
G1503119 NA other downstream 1666199 89768557 ~ 89786154 (+)
G1503337 NA other downstream 2119187 90221545 ~ 90223659 (+)

Expression


G1501543 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1501543 Expression in each Bioproject

Bar chart with 12 bars.
G1501543 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network