G1502114



Basic Information


Item Value
gene id G1502114
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 88253842 ~ 88254100 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1717468
gggatcgatttggaggtggagggtccgtcatggtctggggcagtgtgtcacagcatcatcggactgagcttgttgtcttgaaggcaatctcaacgctgtgcattacagggaagacatccccctccctcatgtggtacccttcctgcaggctcatcctgacatgatcctccagcatgacaatgccaccagccatactgctcgttctgtgcgtgatttcctgcaagacaagaatatcagtgttctgccatggccaacgaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1717468 True 259 lncRNA 0.53 1 88253842 88254100

Neighbor


gene id symbol gene type direction distance location
zgc:171566 LOC106566184 coding downstream 8337 88233684 ~ 88245505 (-)
LOC110494815 NA coding downstream 70085 88181683 ~ 88183757 (-)
dnsl3 dnsl3 coding downstream 78497 88162116 ~ 88175346 (-)
LOC110493297 LOC106566189 coding downstream 94838 88144616 ~ 88159004 (-)
LOC110495200 LOC106566159 coding downstream 746254 87494104 ~ 87507588 (-)
LOC110494809 LOC106566197 coding upstream 183146 88437246 ~ 88600371 (-)
LOC110493292 NA coding upstream 618820 88872775 ~ 88877452 (-)
LOC118940510 LOC106566201 coding upstream 647758 88901858 ~ 88907675 (-)
pcbp4 LOC106566209 coding upstream 1323472 89575961 ~ 89725809 (-)
LOC118940164 NA coding upstream 1545574 89799674 ~ 89801444 (-)
G1502111 NA non-coding downstream 5519 88247911 ~ 88248323 (-)
G1502110 NA non-coding downstream 6232 88247393 ~ 88247610 (-)
G1502103 NA non-coding downstream 21780 88229631 ~ 88232062 (-)
G1502095 NA non-coding downstream 33892 88219031 ~ 88219950 (-)
G1502135 NA non-coding upstream 29889 88283989 ~ 88297048 (-)
G1502136 NA non-coding upstream 37631 88291731 ~ 88296586 (-)
G1502154 NA non-coding upstream 66147 88320247 ~ 88320766 (-)
G1502167 NA non-coding upstream 88700 88342800 ~ 88343152 (-)
G1502489 NA non-coding upstream 104052 88358152 ~ 88425505 (-)
G1501745 NA other downstream 858007 87394780 ~ 87395835 (-)
G1501650 LOC106566166 other downstream 1094598 87134058 ~ 87166800 (-)
LOC110493290 map3k12 other downstream 1447311 86798065 ~ 86880836 (-)
G1500834 LOC106566150 other downstream 1803108 86449679 ~ 86450734 (-)
G1502566 NA other upstream 296266 88550366 ~ 88552831 (-)
G1503624 NA other upstream 1432315 89686415 ~ 89686877 (-)

Expression


G1502114 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1502114 Expression in each Bioproject

Bar chart with 20 bars.
G1502114 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network