G1503090


Basic Information

Item Value
gene id G1503090
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 89715720 ~ 89716306 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1718671
cttgtgttttaggttattgtcctgctgaacggtgaattaatctcccagtgtagatttggccttgtgttttaggttattgtcctgctgaacggtgaattcatctcccagtgtagatttggccttgtgttttaggttattgtcctgctgaacggtgaattcatctcccagtgtagatttggccttgtgttttaggttattgtcctgctgaacggtgaattcatctcccagtgtagatttggccttgtgttttaggttattgtcctgctgaacggtgaattcatctcccagtgtagatttggccttgtgttttaggttattgtcctgctgaacggtgaattcatctccc

Function

NR:

description
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1718671 True 346 lncRNA 0.43 2 89715720 89716306

Neighbor

gene id symbol gene type direction distance location
LOC110494822 LOC106566210 coding upstream 172312 89540160 ~ 89543408 (+)
LOC110494823 LOC106566211 coding upstream 176455 89532719 ~ 89539265 (+)
LOC110493302 LOC106583746 coding upstream 193325 89162750 ~ 89524314 (+)
LOC110493303 LOC106566213 coding upstream 564913 89106147 ~ 89150807 (+)
LOC110494825 LOC106566214 coding upstream 613329 88965847 ~ 89103615 (+)
LOC110494819 LOC106565061 coding downstream 433376 90149682 ~ 90248746 (+)
LOC118940511 NA coding downstream 862038 90578344 ~ 90587307 (+)
LOC110493305 LOC106566226 coding downstream 1768319 91484625 ~ 91522092 (+)
LOC110494826 LOC106601490 coding downstream 2137033 91837358 ~ 91867163 (+)
LOC110519238 vgll4 coding downstream 2199096 91915402 ~ 92011967 (+)
G1503086 NA non-coding upstream 4619 89710644 ~ 89711101 (+)
G1503053 NA non-coding upstream 59729 89652100 ~ 89655991 (+)
G1503034 NA non-coding upstream 108516 89606460 ~ 89607204 (+)
G1503029 NA non-coding upstream 116145 89599259 ~ 89599575 (+)
G1503094 NA non-coding downstream 7740 89724046 ~ 89724413 (+)
G1503101 NA non-coding downstream 19268 89735574 ~ 89738005 (+)
G1503126 NA non-coding downstream 60099 89776405 ~ 89777041 (+)
G1503163 NA non-coding downstream 171683 89887989 ~ 89910320 (+)
G1503195 NA non-coding downstream 263085 89979391 ~ 89979633 (+)
G1502370 NA other upstream 906751 88806978 ~ 88808969 (+)
G1502352 NA other upstream 915080 88769870 ~ 88800640 (+)
LOC110494816 LOC106566192 other upstream 1590846 88089634 ~ 88143474 (+)
LOC110494789 bloc1s1 other upstream 2228830 87415720 ~ 87486890 (+)
G1503119 NA other downstream 52251 89768557 ~ 89786154 (+)
G1503337 NA other downstream 505239 90221545 ~ 90223659 (+)
LOC110504503 LOC106566236 other downstream 2568749 92282926 ~ 92317484 (+)
G1505894 NA other downstream 2603239 92319545 ~ 92320777 (+)
G1505924 LOC106566233 other downstream 2732280 92447734 ~ 92467632 (+)

Expression


Co-expression Network