G1504024



Basic Information


Item Value
gene id G1504024
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 90388401 ~ 90389579 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1719750
AACTGCATATATAATGCTCTGGTCTGTACTAGGGGTGAGGGTTAACTGCATATCTAATGCTCTGGTCTGTACTAGGGGTGAGGGGTTAACTGCATATCTAATGCTCTGGTCTGTACTAGGGGTGAGGGGTTAACTGCATATCTAATGCTCTGGTCTGTACTAGTGGTGAGGGGTTAACTTCATATCTAATGCTCTGGTCTGTACTAGGGGTGAGGGTTAACTGCATATCTAATGCTCTGGTCTGTACTAGGGGTGAGGGGTTAACTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1719750 True 267 lncRNA 0.46 3 90388401 90389579
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494819 LOC106565061 coding upstream 139655 90149682 ~ 90248746 (+)
LOC110494822 LOC106566210 coding upstream 844993 89540160 ~ 89543408 (+)
LOC110494823 LOC106566211 coding upstream 849136 89532719 ~ 89539265 (+)
LOC110493302 LOC106583746 coding upstream 866006 89162750 ~ 89524314 (+)
LOC110493303 LOC106566213 coding upstream 1237594 89106147 ~ 89150807 (+)
LOC118940511 NA coding downstream 188765 90578344 ~ 90587307 (+)
LOC110493305 LOC106566226 coding downstream 1095046 91484625 ~ 91522092 (+)
LOC110494826 LOC106601490 coding downstream 1463760 91837358 ~ 91867163 (+)
LOC110519238 vgll4 coding downstream 1525823 91915402 ~ 92011967 (+)
LOC118940512 NA coding downstream 1625958 92015537 ~ 92020588 (+)
G1504013 NA non-coding upstream 14418 90373711 ~ 90373983 (+)
G1504012 NA non-coding upstream 14805 90373378 ~ 90373596 (+)
G1503976 NA non-coding upstream 47958 90340164 ~ 90340443 (+)
G1503969 NA non-coding upstream 53712 90334464 ~ 90334689 (+)
G1503966 NA non-coding upstream 56706 90331487 ~ 90331695 (+)
G1504037 NA non-coding downstream 9079 90398658 ~ 90399012 (+)
G1504049 NA non-coding downstream 23827 90413406 ~ 90413785 (+)
G1504060 NA non-coding downstream 31223 90420802 ~ 90421096 (+)
G1504061 NA non-coding downstream 32004 90421583 ~ 90441203 (+)
G1504073 NA non-coding downstream 48523 90438102 ~ 90438937 (+)
G1503337 NA other upstream 164742 90221545 ~ 90223659 (+)
G1503119 NA other upstream 602247 89768557 ~ 89786154 (+)
G1502370 NA other upstream 1579432 88806978 ~ 88808969 (+)
G1502352 NA other upstream 1587761 88769870 ~ 88800640 (+)
LOC110504503 LOC106566236 other downstream 1895476 92282926 ~ 92317484 (+)
G1505894 NA other downstream 1929966 92319545 ~ 92320777 (+)
G1505924 LOC106566233 other downstream 2059007 92447734 ~ 92467632 (+)
G1506406 NA other downstream 2476627 92866206 ~ 92867034 (+)
G1506889 NA other downstream 3187238 93576817 ~ 93577604 (+)

Expression


G1504024 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G1504024 Expression in each Bioproject

Bar chart with 11 bars.
G1504024 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network