LOC118941026



Basic Information


Item Value
gene id LOC118941026
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 5946747 ~ 5947078 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005037317.1
ATAGGAGGGTGAGGTAGACGGGTATAGGAGGGCTCCCCGGTGAGGTAGACGGGTATAGGAGGGCTCCCCGGTGAGGTAGACGGGTATAGGAGGGCTCCCCGGTGAGGTAGACGGGTATAGGAGGGCTCCCCGGTGAGGTAGACGGGTATAGGAGGGTGAGGTAGACGGGTATAGGAGGGTGAGGTAGACGGGTATAGGAGGGTGAGGTAGACGGGTATAGGAGGGTGAGGTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005037317.1 True 232 mRNA 0.60 3 5946747 5947078
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110510710 LOC106575389 coding upstream 207136 5152929 ~ 5739611 (+)
LOC110519537 LOC106592870 coding upstream 238281 5704751 ~ 5708466 (+)
LOC110513970 LOC106575958 coding upstream 243777 5461902 ~ 5702970 (+)
LOC110495587 LOC106592870 coding upstream 309557 5526363 ~ 5637190 (+)
LOC118941025 NA coding upstream 353403 5591627 ~ 5593672 (+)
LOC118941029 NA coding downstream 464 5947542 ~ 5948154 (+)
LOC110519329 atp4b coding downstream 54666 6001744 ~ 6007442 (+)
LOC118941024 dcun1d2 coding downstream 102324 5998183 ~ 6065189 (+)
LOC110511044 adprhl1 coding downstream 123696 6070774 ~ 6082183 (+)
LOC110527156 LOC106575911 coding downstream 135215 6082293 ~ 6096601 (+)
G1512440 NA non-coding upstream 19185 5926894 ~ 5927562 (+)
G1512413 NA non-coding upstream 31829 5914695 ~ 5914918 (+)
G1511880 NA non-coding upstream 47362 5898285 ~ 5899385 (+)
G1511942 NA non-coding upstream 48738 5897735 ~ 5898009 (+)
G1512410 NA non-coding upstream 49934 5895484 ~ 5896813 (+)
G1512443 NA non-coding downstream 3593 5950671 ~ 5950935 (+)
G1512448 NA non-coding downstream 10345 5957423 ~ 5958678 (+)
G1512453 NA non-coding downstream 21047 5968125 ~ 5969224 (+)
G1512454 NA non-coding downstream 30251 5977329 ~ 5978539 (+)
G1512457 NA non-coding downstream 40257 5987335 ~ 5998317 (+)
G1512309 NA other upstream 333711 5607908 ~ 5613036 (+)
G1512205 NA other upstream 703320 5242734 ~ 5243427 (+)
G1512182 NA other upstream 840659 5104087 ~ 5106088 (+)
LOC110495595 LOC106574881 other upstream 920417 4895914 ~ 5043592 (+)
LOC110518779 dis3 other downstream 230762 6172823 ~ 6188926 (+)
LOC110495361 LOC106575795 other downstream 451685 6398763 ~ 6403517 (+)
LOC110496964 LOC106594657 other downstream 493774 6404433 ~ 6459931 (+)
LOC110514219 LOC106594890 other downstream 603567 6493403 ~ 6573608 (+)
LOC110516612 LOC106574917 other downstream 761581 6705632 ~ 6710286 (+)

Expression


LOC118941026 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

LOC118941026 Expression in each Bioproject

Bar chart with 16 bars.
LOC118941026 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network