LOC118941235



Basic Information


Item Value
gene id LOC118941235
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 33510802 ~ 33510928 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005037564.1
CCCGCCACTATGCTGGTCTGTTTCAGTGACTGAGTATAATCCAGTGGAGGCTCAGATAGACCCAGCTCTAGGAAGCAGGGCTGCCTAAACAAATGGGCAACTCTGTGCCGAAAGGCCTGGAACAAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005037564.1 True 127 mRNA 0.53 1 33510802 33510928

Neighbor


gene id symbol gene type direction distance location
LOC118941240 NA coding upstream 459 33510212 ~ 33510343 (+)
LOC110496041 LOC106588210 coding upstream 21778 33480096 ~ 33489024 (+)
LOC110496797 LOC106570068 coding upstream 51838 33455560 ~ 33458964 (+)
LOC110496040 LOC106588209 coding upstream 60701 33433366 ~ 33450101 (+)
nrm nrm coding upstream 84250 33420834 ~ 33426552 (+)
LOC118941241 NA coding downstream 902 33511830 ~ 33511959 (+)
LOC110496043 LOC106588212 coding downstream 24301 33535229 ~ 33537569 (+)
LOC110496055 LOC106588221 coding downstream 427754 33938682 ~ 34059960 (+)
LOC110496056 dpy19l4 coding downstream 569180 34080108 ~ 34088560 (+)
ints8 ints8 coding downstream 581319 34092247 ~ 34116282 (+)
G1540563 NA non-coding upstream 7319 33503265 ~ 33503483 (+)
G1540562 NA non-coding upstream 9369 33501214 ~ 33501433 (+)
G1540561 NA non-coding upstream 9685 33500915 ~ 33501117 (+)
G1540545 NA non-coding upstream 33203 33477310 ~ 33477599 (+)
G1540543 NA non-coding upstream 33983 33476309 ~ 33476819 (+)
G1540553 NA non-coding downstream 3280 33514208 ~ 33517215 (+)
G1540567 NA non-coding downstream 13395 33524323 ~ 33524542 (+)
G1540568 NA non-coding downstream 13885 33524813 ~ 33525053 (+)
G1540586 NA non-coding downstream 43858 33554786 ~ 33558100 (+)
G1540588 NA non-coding downstream 59351 33570279 ~ 33579015 (+)
G1540551 NA other upstream 19681 33489337 ~ 33491121 (+)
G1539671 LOC106582599 other upstream 450945 33058990 ~ 33059857 (+)
G1539641 NA other upstream 490258 33020228 ~ 33020544 (+)
G1538208 LOC106588182 other upstream 1756611 31753710 ~ 31754191 (+)
G1540996 NA other downstream 567790 34078718 ~ 34079074 (+)
LOC110496058 LOC106588349 other downstream 617413 34127192 ~ 34133734 (+)
mbpa LOC106588233 other downstream 1372586 34883492 ~ 34898413 (+)
G1541989 NA other downstream 1771675 35282603 ~ 35283706 (+)

Expression


LOC118941235 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

LOC118941235 Expression in each Bioproject

Bar chart with 16 bars.
LOC118941235 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network