G1513211



Basic Information


Item Value
gene id G1513211
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 6425551 ~ 6426843 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1731455
agatgtggttgtcccccctcactatgactgagatgtggttgtcccacctcactatgactgagatgtggttgtcccaactcactatgactgagatgtggttgtcccaactcactatgactgagatgtggttgtcccaactcactatgactgagatgtggttgtccctcactatgactgagatgttgttgtccctcactatgactgagatgttgttgtccc

Function


NR:

description
uncharacterized protein LOC111644191

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1731455 True 219 lncRNA 0.48 2 6425551 6426843

Neighbor


gene id symbol gene type direction distance location
LOC110495361 LOC106575795 coding upstream 22034 6398763 ~ 6403517 (+)
LOC110512784 LOC106574826 coding upstream 41137 6351916 ~ 6384414 (+)
ubac2 LOC106591293 coding upstream 73770 6318901 ~ 6351781 (+)
mzt1 NA coding upstream 222303 6201385 ~ 6203248 (+)
LOC110518779 dis3 coding upstream 236625 6172823 ~ 6188926 (+)
LOC118941080 NA coding downstream 63388 6490231 ~ 6491752 (+)
LOC110514219 LOC106594890 coding downstream 66560 6493403 ~ 6573608 (+)
LOC110516612 LOC106574917 coding downstream 278789 6705632 ~ 6710286 (+)
syap1 syap1 coding downstream 380436 6807279 ~ 6815407 (+)
LOC110495421 LOC106593174 coding downstream 388643 6815486 ~ 6837266 (+)
G1513205 NA non-coding upstream 15155 6409964 ~ 6410396 (+)
G1513204 NA non-coding upstream 17691 6407412 ~ 6407860 (+)
G1513183 NA non-coding upstream 31448 6393699 ~ 6394103 (+)
G1513181 NA non-coding upstream 35234 6390040 ~ 6390317 (+)
G1513200 NA non-coding downstream 35106 6461949 ~ 6462786 (+)
G1513197 NA non-coding downstream 37439 6464282 ~ 6464972 (+)
G1513218 NA non-coding downstream 39436 6466279 ~ 6466580 (+)
G1513201 NA non-coding downstream 40946 6467789 ~ 6468089 (+)
G1513199 NA non-coding downstream 41318 6468161 ~ 6468432 (+)
LOC110513970 LOC106575958 other upstream 754218 5461902 ~ 5702970 (+)
G1512309 NA other upstream 812515 5607908 ~ 5613036 (+)
G1512205 NA other upstream 1182124 5242734 ~ 5243427 (+)
LOC110496964 LOC106594657 other downstream 14009 6404433 ~ 6459931 (+)
G1513452 NA other downstream 599365 7026208 ~ 7026810 (+)
LOC110513752 LOC106575969 other downstream 605767 7032578 ~ 7102239 (+)

Expression


G1513211 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1513211 Expression in each Bioproject

Bar chart with 15 bars.
G1513211 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network