G1517948 (tuba8l2)


Basic Information

Item Value
gene id G1517948
gene name tuba8l2
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 12395818 ~ 12402098 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1737695
TGTCAATCAGTCAGTGGATTTTCTCTGCCAGATCCCTCCAATACTCACCAATGACAGTGGGCTCCAGGTCTACAAAGATGGCGCGGGGTACGTATTTCCCGATGCCCGTGGCGCTGAAGAACGTGGTGAAGGAGTCGTCAGTGCTACCGACCGCCTTGTTGTTAGGCATGGTGCCGTCCGGCTGGATCCCGTGCTCCAGGCAGTACAGCTCCCAACAGGTGTTGCCCATCTGGACTCCAGCCTGACCCACATGCACAGAGATACACTCACGCTTTTGATTCTGTTTGTCTTCGTTTCCGTAGAAAAATAAAAGTGTTGGTGGTATAACCTCTCACAGTGAACCTATAATGGGGTCTCCGTGAGTATGTTTTAACTGCGTGTGTTACTGCAATCTGTTTTTATAAACTGCGAAGGGCGGGGGTGGAGTTTTGGACA

Function

symbol description
tuba8l2 Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Predicted to act upstream of or within microtubule-based process. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and microtubule. Is expressed in gill. Human ortholog(s) of this gene implicated in amyotrophic lateral sclerosis type 22. Orthologous to human TUBA4A (tubulin alpha 4a).

NR:

description
tubulin alpha-4A chain

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1737695 True 435 lncRNA 0.51 2 12395818 12402098

Neighbor

gene id symbol gene type direction distance location
LOC110516060 LOC106575774 coding downstream 14825 12354052 ~ 12380993 (-)
LOC110497022 LOC106574871 coding downstream 53488 12330934 ~ 12342330 (-)
ck073 ck073 coding downstream 107716 12281631 ~ 12288102 (-)
LOC110495544 LOC106575695 coding downstream 123630 12260777 ~ 12272188 (-)
LOC118936562 LOC106594175 coding downstream 143269 12250356 ~ 12252549 (-)
LOC110528732 LOC105019714 coding upstream 67986 12470084 ~ 12506726 (-)
LOC110527216 nud15 coding upstream 150570 12552668 ~ 12553871 (-)
LOC118941039 NA coding upstream 169624 12571503 ~ 12583644 (-)
LOC110495529 LOC106575665 coding upstream 209916 12612014 ~ 12616159 (-)
LOC118941036 NA coding upstream 263748 12665846 ~ 12677668 (-)
G1517935 NA non-coding downstream 34986 12359370 ~ 12360832 (-)
G1517933 NA non-coding downstream 49786 12345806 ~ 12346032 (-)
G1517924 NA non-coding downstream 77089 12316417 ~ 12318729 (-)
G1517919 NA non-coding downstream 85569 12309953 ~ 12310249 (-)
G1517918 NA non-coding downstream 86205 12309059 ~ 12309613 (-)
G1517951 NA non-coding upstream 2490 12404588 ~ 12405881 (-)
G1517955 NA non-coding upstream 11534 12413632 ~ 12415091 (-)
G1517963 NA non-coding upstream 31616 12433714 ~ 12433935 (-)
G1517965 NA non-coding upstream 33508 12435606 ~ 12435967 (-)
G1517970 NA non-coding upstream 43192 12445290 ~ 12445526 (-)
G1517902 NA other downstream 110186 12285078 ~ 12285632 (-)
LOC110512633 LOC106575771 other downstream 150075 12240234 ~ 12245743 (-)
G1517822 LOC106575686 other downstream 373378 12020772 ~ 12023228 (-)
G1517784 NA other downstream 447473 11947565 ~ 11948345 (-)
G1518019 LOC106575703 other upstream 181630 12583728 ~ 12600331 (-)
LOC110495512 LOC106574713 other upstream 504113 12898791 ~ 12910954 (-)
LOC110513917 LOC106575727 other upstream 569555 12933662 ~ 13031321 (-)
bcor LOC106574692 other upstream 982658 13312628 ~ 13402659 (-)
G1518858 LOC106574768 other upstream 1337353 13739451 ~ 13741567 (-)

Expression


Co-expression Network