G1519196



Basic Information


Item Value
gene id G1519196
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 14263286 ~ 14264083 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1739193
gtggtgactaaagtagttcattcaggtgctgtataaccagtcacataatgaatgtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacataatgaatgtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacatactgaatgtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacatactgaatgtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacataatgaatgtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacataatgaatgtgtgttgactaaagtagttaattgaggtgctgtataaccagtcacataatgaaggtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacataatgaaggtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacataatgaatgtgtggtgactaaagtagttaattgaggtgctgtataaccagtcacataatgaatgtgtggtgactaaagtagttcattcaggtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1739193 True 578 lncRNA 0.37 2 14263286 14264083

Neighbor


gene id symbol gene type direction distance location
LOC110495485 LOC106575653 coding upstream 283399 13975110 ~ 13979887 (+)
LOC110495487 LOC106574771 coding upstream 294097 13883956 ~ 13969189 (+)
LOC118941229 NA coding upstream 451998 13811236 ~ 13811288 (+)
LOC110495495 LOC106574775 coding upstream 640468 13592980 ~ 13622818 (+)
LOC110497006 LOC106574795 coding upstream 706934 13520158 ~ 13556352 (+)
LOC110495481 LOC106574739 coding downstream 292893 14556326 ~ 14558589 (+)
LOC110495476 LOC106575616 coding downstream 324568 14588651 ~ 14643860 (+)
LOC110495457 LOC106573985 coding downstream 489353 14753436 ~ 14764586 (+)
LOC110496915 LOC106575634 coding downstream 515007 14779090 ~ 14780827 (+)
zgc:92380 LOC106575639 coding downstream 528854 14792937 ~ 14799311 (+)
G1519182 NA non-coding upstream 23087 14239775 ~ 14240199 (+)
G1519177 NA non-coding upstream 40233 14222715 ~ 14223053 (+)
G1519170 NA non-coding upstream 49221 14213825 ~ 14214065 (+)
G1519164 NA non-coding upstream 55042 14207981 ~ 14208244 (+)
G1519161 NA non-coding upstream 57852 14205225 ~ 14205434 (+)
G1519209 NA non-coding downstream 21132 14285215 ~ 14286044 (+)
G1519226 NA non-coding downstream 57706 14321789 ~ 14322013 (+)
G1519228 NA non-coding downstream 61444 14325527 ~ 14325788 (+)
G1519229 NA non-coding downstream 62328 14326411 ~ 14326667 (+)
G1519231 NA non-coding downstream 63881 14327964 ~ 14328225 (+)
G1517545 NA other upstream 1075206 13187101 ~ 13188080 (+)
G1517457 NA other upstream 1320792 12937523 ~ 12942494 (+)
G1517456 LOC106575727 other upstream 1327008 12934654 ~ 12936278 (+)
G1517414 LOC106575752 other upstream 1391123 12833651 ~ 12872163 (+)
G1517150 NA other upstream 2322181 11940062 ~ 11941897 (+)
G1519096 NA other downstream 170679 14434762 ~ 14436120 (+)
G1519538 NA other downstream 234703 14498786 ~ 14499137 (+)
G1519733 NA other downstream 549899 14813982 ~ 14814886 (+)
il8r il8r other downstream 634173 14898154 ~ 14901354 (+)

Expression


G1519196 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1519196 Expression in each Bioproject

Bar chart with 9 bars.
G1519196 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 350.
End of interactive chart.

Co-expression Network