G1519234



Basic Information


Item Value
gene id G1519234
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 14330253 ~ 14330776 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1739235
ttccagttctctgctgccaatgactggaacgaactacaaaaatctctgaaactggaaacacttatctccctcactagctttaagcaccaactgtcagagcagctcacagattactgcacctgtacatagcccacctataatgtagcccaaacaactacctcgttccctactgtattttatttatttatttattttgctcctttgcaccccattatttgtatttctactttgcacattcttccattgcaaatctaccattccagtgttttatttgctatattgtatttactttgccaccatggcctttttttgcctttacctcccttctcacctcatttgctcacatcgtatatagacttgtttatactgtattattgactgtatgtttgttttactccatgtgtaactctgtgtcgttgtatctgtcgaactgctttgctttatcttggccaggtcgcaatcgcaattgtaaatgagaacttgttctcaacttgcctacctggttaaataaaggtgaaataaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1739235 True 524 lncRNA 0.38 1 14330253 14330776

Neighbor


gene id symbol gene type direction distance location
LOC110495485 LOC106575653 coding upstream 350366 13975110 ~ 13979887 (+)
LOC110495487 LOC106574771 coding upstream 361064 13883956 ~ 13969189 (+)
LOC118941229 NA coding upstream 518965 13811236 ~ 13811288 (+)
LOC110495495 LOC106574775 coding upstream 707435 13592980 ~ 13622818 (+)
LOC110497006 LOC106574795 coding upstream 773901 13520158 ~ 13556352 (+)
LOC110495481 LOC106574739 coding downstream 226200 14556326 ~ 14558589 (+)
LOC110495476 LOC106575616 coding downstream 257875 14588651 ~ 14643860 (+)
LOC110495457 LOC106573985 coding downstream 422660 14753436 ~ 14764586 (+)
LOC110496915 LOC106575634 coding downstream 448314 14779090 ~ 14780827 (+)
zgc:92380 LOC106575639 coding downstream 462161 14792937 ~ 14799311 (+)
G1519233 NA non-coding upstream 74 14329950 ~ 14330179 (+)
G1519232 NA non-coding upstream 545 14329422 ~ 14329708 (+)
G1519231 NA non-coding upstream 2028 14327964 ~ 14328225 (+)
G1519229 NA non-coding upstream 3586 14326411 ~ 14326667 (+)
G1519228 NA non-coding upstream 4465 14325527 ~ 14325788 (+)
G1519235 NA non-coding downstream 2402 14333178 ~ 14333400 (+)
G1519236 NA non-coding downstream 2936 14333712 ~ 14333915 (+)
G1519238 NA non-coding downstream 4194 14334970 ~ 14335245 (+)
G1519245 NA non-coding downstream 19479 14350255 ~ 14350468 (+)
G1519247 NA non-coding downstream 21109 14351885 ~ 14352088 (+)
G1517545 NA other upstream 1142173 13187101 ~ 13188080 (+)
G1517457 NA other upstream 1387759 12937523 ~ 12942494 (+)
G1517456 LOC106575727 other upstream 1393975 12934654 ~ 12936278 (+)
G1517414 LOC106575752 other upstream 1458090 12833651 ~ 12872163 (+)
G1517150 NA other upstream 2389148 11940062 ~ 11941897 (+)
G1519096 NA other downstream 103986 14434762 ~ 14436120 (+)
G1519538 NA other downstream 168010 14498786 ~ 14499137 (+)
G1519733 NA other downstream 483206 14813982 ~ 14814886 (+)
il8r il8r other downstream 567480 14898154 ~ 14901354 (+)

Expression


G1519234 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1519234 Expression in each Bioproject

Bar chart with 19 bars.
G1519234 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network