G1520804



Basic Information


Item Value
gene id G1520804
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 16155900 ~ 16156236 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1741137
gttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1741137 True 281 lncRNA 0.42 2 16155900 16156236
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495657 LOC100380633 coding upstream 66011 16075992 ~ 16089889 (+)
LOC110495658 LOC100136184 coding upstream 94955 16047145 ~ 16060945 (+)
LOC110495655 LOC106574721 coding upstream 134004 16009775 ~ 16021896 (+)
LOC110495654 LOC106575575 coding upstream 159041 15993613 ~ 15996859 (+)
LOC110495649 LOC106574731 coding upstream 290861 15852644 ~ 15865039 (+)
LOC110495667 LOC106575562 coding downstream 116000 16272236 ~ 16277918 (+)
LOC110497062 LOC106575548 coding downstream 132645 16288881 ~ 16332222 (+)
LOC110495668 LOC106575499 coding downstream 182089 16338325 ~ 16345761 (+)
LOC110495670 tgds coding downstream 196597 16352833 ~ 16367882 (+)
gucy1b2 LOC106575503 coding downstream 266009 16422245 ~ 16427538 (+)
G1520797 NA non-coding upstream 102503 16053091 ~ 16053397 (+)
G1520787 NA non-coding upstream 123500 16032153 ~ 16032400 (+)
G1520782 NA non-coding upstream 130185 16025516 ~ 16025715 (+)
G1520781 NA non-coding upstream 130633 16024980 ~ 16025267 (+)
G1520780 NA non-coding upstream 131123 16024542 ~ 16024777 (+)
G1520721 NA non-coding downstream 1031 16157267 ~ 16203602 (+)
G1520733 NA non-coding downstream 28977 16185213 ~ 16191473 (+)
G1520736 NA non-coding downstream 29749 16185985 ~ 16192172 (+)
G1520876 NA non-coding downstream 74341 16230577 ~ 16231069 (+)
G1520748 NA other upstream 217082 15938230 ~ 15938818 (+)
G1520742 NA other upstream 233001 15919157 ~ 15922899 (+)
G1520649 NA other upstream 339895 15756493 ~ 15816005 (+)
LOC110495644 LOC106575583 other upstream 356019 15796262 ~ 15801788 (+)
LOC110495440 LOC106575601 other upstream 939656 15207355 ~ 15251952 (+)
LOC110495674 LOC106575504 other downstream 309277 16454118 ~ 16468453 (+)
LOC110527374 LOC106592210 other downstream 1467580 17623786 ~ 17631132 (+)
G1522415 LOC106575491 other downstream 1609983 17766219 ~ 17766694 (+)
G1522437 LOC106575479 other downstream 1683433 17839669 ~ 17844014 (+)
G1522438 NA other downstream 1699905 17856141 ~ 17860614 (+)

Expression


G1520804 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1520804 Expression in each Bioproject

Bar chart with 12 bars.
G1520804 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network