G1525105



Basic Information


Item Value
gene id G1525105
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 20527718 ~ 20528164 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1746258
GCATTGTTAGTGTAACATCTCTCAAATCATGCACTCACTCAGCTTGTTTAAGGTTCAGACAGTGAAAAAGCACAGTAATGCGCGCAGGGTATCGCGGTATACAGTGCAATATAGGATTTGAAAAGGCTAGCGGGAAAGACCAATACAGAGGTATCAAAAACAGTAACTTACCAATCATGTTGTCAAACCATCACGAAAAAACGGGCAACTGTATAAGATGACGTCCCGTATTGGCTAAAATAAACGAATGAGTAGCCTAAATGACAACTGTTAAATGAAAGGCTAATTATCAATGCAGCTGAAACGATATTTGCGCACCATTCACACAAAAGCATAACAGAGTGACATGGTGCTGTAATTGATTTATGTCGTAAATGAATTAGTAGGTTTTGCAGCACGACGGACGCGTGGAGGATTCTTCGGCTGCGCGCGCTGACAATGGTGGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1746258 True 447 lncRNA 0.42 1 20527718 20528164
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495793 LOC106575303 coding downstream 3843 20468182 ~ 20523875 (-)
LOC110495790 LOC106574555 coding downstream 64925 20351488 ~ 20462793 (-)
LOC110495789 LOC106574554 coding downstream 218268 20304687 ~ 20309450 (-)
LOC110495787 LOC106574546 coding downstream 236898 20259167 ~ 20290820 (-)
LOC110495786 LOC106574549 coding downstream 272498 20251274 ~ 20255220 (-)
LOC110497093 LOC106574562 coding upstream 30393 20558557 ~ 20595753 (-)
LOC110495796 LOC106575332 coding upstream 88570 20616734 ~ 20620719 (-)
LOC118941121 NA coding upstream 258909 20787073 ~ 20835521 (-)
zgc:92027 gran coding upstream 327260 20855424 ~ 20863001 (-)
LOC110495804 LOC106574399 coding upstream 372338 20900502 ~ 20947386 (-)
G1525035 LOC101478692 non-coding downstream 226323 20300556 ~ 20301395 (-)
G1525060 NA non-coding downstream 259983 20267247 ~ 20267735 (-)
G1525059 NA non-coding downstream 261263 20266167 ~ 20266455 (-)
G1525057 NA non-coding downstream 277064 20250407 ~ 20250654 (-)
G1525022 NA non-coding downstream 331704 20195809 ~ 20196014 (-)
G1525107 NA non-coding upstream 2861 20531025 ~ 20531299 (-)
G1525132 NA non-coding upstream 25759 20553923 ~ 20554810 (-)
G1525152 NA non-coding upstream 87622 20615786 ~ 20616039 (-)
G1525195 NA non-coding upstream 122018 20650182 ~ 20650404 (-)
G1525255 NA non-coding upstream 164648 20692812 ~ 20693057 (-)
G1524755 LOC106581475 other downstream 797650 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 950618 19573628 ~ 19577133 (-)
G1524473 LOC106574589 other downstream 1363592 19143985 ~ 19164126 (-)
G1524311 NA other downstream 1778323 18749125 ~ 18749395 (-)
G1523241 NA other downstream 1960471 18561906 ~ 18567247 (-)
G1527230 NA other upstream 1733892 22262056 ~ 22262462 (-)
G1528018 NA other upstream 2343881 22872045 ~ 22885833 (-)
LOC110495841 LOC106574435 other upstream 2631394 23008547 ~ 23168591 (-)
LOC110495851 LOC106574449 other upstream 2953376 23479558 ~ 23541681 (-)

Expression


G1525105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1525105 Expression in each Bioproject

Bar chart with 6 bars.
G1525105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network