G1525152



Basic Information


Item Value
gene id G1525152
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 20615786 ~ 20616039 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1746314
ggagcagtagaaacatgatgaatcacgcttcaccatctggctgtccgacagacaaatctggatttggcggatgccaggagaacgctacctgcccaaatgtatagtgctaactgtaaaatttggcgaaggagaaataatggtctggggctgttttgcaaggttcgggctaggccccttagttccagtgaagggaaatcttaacgctacagcatacaatgacattctaaacaattctgtgcttccaacttccaggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1746314 True 254 lncRNA 0.47 1 20615786 20616039

Neighbor


gene id symbol gene type direction distance location
LOC110497093 LOC106574562 coding downstream 20033 20558557 ~ 20595753 (-)
LOC110495793 LOC106575303 coding downstream 91911 20468182 ~ 20523875 (-)
LOC110495790 LOC106574555 coding downstream 152993 20351488 ~ 20462793 (-)
LOC110495789 LOC106574554 coding downstream 306336 20304687 ~ 20309450 (-)
LOC110495787 LOC106574546 coding downstream 324966 20259167 ~ 20290820 (-)
LOC110495796 LOC106575332 coding upstream 695 20616734 ~ 20620719 (-)
LOC118941121 NA coding upstream 171034 20787073 ~ 20835521 (-)
zgc:92027 gran coding upstream 239385 20855424 ~ 20863001 (-)
LOC110495804 LOC106574399 coding upstream 284463 20900502 ~ 20947386 (-)
LOC110495806 LOC106574400 coding upstream 333091 20949130 ~ 20955845 (-)
G1525132 NA non-coding downstream 60976 20553923 ~ 20554810 (-)
G1525107 NA non-coding downstream 84487 20531025 ~ 20531299 (-)
G1525105 NA non-coding downstream 87622 20527718 ~ 20528164 (-)
G1525035 LOC101478692 non-coding downstream 314391 20300556 ~ 20301395 (-)
G1525060 NA non-coding downstream 348051 20267247 ~ 20267735 (-)
G1525195 NA non-coding upstream 34143 20650182 ~ 20650404 (-)
G1525255 NA non-coding upstream 76773 20692812 ~ 20693057 (-)
G1525260 LOC106574564 non-coding upstream 77530 20693569 ~ 20694149 (-)
G1525265 NA non-coding upstream 88589 20704628 ~ 20704830 (-)
G1525268 NA non-coding upstream 90638 20706677 ~ 20707081 (-)
G1524755 LOC106581475 other downstream 885718 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 1038686 19573628 ~ 19577133 (-)
G1524473 LOC106574589 other downstream 1451660 19143985 ~ 19164126 (-)
G1524311 NA other downstream 1866391 18749125 ~ 18749395 (-)
G1527230 NA other upstream 1646017 22262056 ~ 22262462 (-)
G1528018 NA other upstream 2256006 22872045 ~ 22885833 (-)
LOC110495841 LOC106574435 other upstream 2543519 23008547 ~ 23168591 (-)
LOC110495851 LOC106574449 other upstream 2865501 23479558 ~ 23541681 (-)
LOC110495852 LOC106574460 other upstream 2926567 23542411 ~ 23543631 (-)

Expression


G1525152 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1525152 Expression in each Bioproject

Bar chart with 17 bars.
G1525152 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network