G1525312



Basic Information


Item Value
gene id G1525312
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 20748190 ~ 20748438 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1746477
ccgggggcaaactacctgccctccaggacacctacaccacccgatgttacaggaaggccataaagatcatcaaggacatcaaccacccgagccactgcctgttcaccccgctatcatccagaaggcgaggtcagtacaggtgcatcaaagctgggactgagagactgaaaaacagcttctatctcaaggccatcagactgttaaacagccaccactaacattgagtggctgctgccaacacactgacac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1746477 True 249 lncRNA 0.53 1 20748190 20748438
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495796 LOC106575332 coding downstream 127471 20616734 ~ 20620719 (-)
LOC110497093 LOC106574562 coding downstream 152437 20558557 ~ 20595753 (-)
LOC110495793 LOC106575303 coding downstream 224315 20468182 ~ 20523875 (-)
LOC110495790 LOC106574555 coding downstream 285397 20351488 ~ 20462793 (-)
LOC110495789 LOC106574554 coding downstream 438740 20304687 ~ 20309450 (-)
LOC118941121 NA coding upstream 38635 20787073 ~ 20835521 (-)
zgc:92027 gran coding upstream 106986 20855424 ~ 20863001 (-)
LOC110495804 LOC106574399 coding upstream 152064 20900502 ~ 20947386 (-)
LOC110495806 LOC106574400 coding upstream 200692 20949130 ~ 20955845 (-)
LOC110495808 psde coding upstream 207441 20955879 ~ 20966920 (-)
G1525297 NA non-coding downstream 19038 20728920 ~ 20729152 (-)
G1525279 NA non-coding downstream 32803 20715175 ~ 20715387 (-)
G1525268 NA non-coding downstream 41109 20706677 ~ 20707081 (-)
G1525265 NA non-coding downstream 43360 20704628 ~ 20704830 (-)
G1525260 LOC106574564 non-coding downstream 54041 20693569 ~ 20694149 (-)
G1525597 NA non-coding upstream 143631 20892069 ~ 20892347 (-)
G1525645 tceanc non-coding upstream 275908 21024346 ~ 21024693 (-)
G1525646 NA non-coding upstream 276379 21024817 ~ 21025196 (-)
G1525649 NA non-coding upstream 281595 21030033 ~ 21030807 (-)
G1525650 NA non-coding upstream 282770 21031208 ~ 21031411 (-)
G1524755 LOC106581475 other downstream 1018122 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 1171090 19573628 ~ 19577133 (-)
G1524473 LOC106574589 other downstream 1584064 19143985 ~ 19164126 (-)
G1524311 NA other downstream 1998795 18749125 ~ 18749395 (-)
G1527230 NA other upstream 1513618 22262056 ~ 22262462 (-)
G1528018 NA other upstream 2123607 22872045 ~ 22885833 (-)
LOC110495841 LOC106574435 other upstream 2411120 23008547 ~ 23168591 (-)
LOC110495851 LOC106574449 other upstream 2733102 23479558 ~ 23541681 (-)
LOC110495852 LOC106574460 other upstream 2794168 23542411 ~ 23543631 (-)

Expression


G1525312 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1525312 Expression in each Bioproject

Bar chart with 15 bars.
G1525312 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network