G1525645 (tceanc)


Basic Information

Item Value
gene id G1525645
gene name tceanc
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 21024346 ~ 21024693 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1746864
CGAGAGGCAGCTCCCCAAGGACCTGGAGGGGACACCCACCCCGAAGCTGCGGTGCGAGGGGTCGGACTGCAGGGTGACGCGGATGTCCCGGGGCACGCTGTTTCTGCCGGCGTGGGTTCGCCAGGCCACTGCAGACCAGGATGCCATGACCTTTGTGACCTGTAGCAGGTGTGGGGAGCAGTGGTACCACAGCGGCTGGGTGTGCCTCTGATAGGCCATCCTCACCACACCACATGTAAAATGCCTGCTTTGTTTTTGTCGAGATCCTGATGATACGTCTTCACCCTATCAAACTGAATAATGTCATGTTTTAATGACAGAAATGAAGAATTACATTTCACATTTTAC

Function

symbol description
tceanc Predicted to be involved in transcription, DNA-templated. Predicted to be located in nucleus.

NR:

description
transcription elongation factor A N-terminal and central domain-containing protein

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1746864 True 348 lncRNA 0.55 1 21024346 21024693

Neighbor

gene id symbol gene type direction distance location
LOC110495807 LOC106574402 coding downstream 47348 20968247 ~ 20976998 (-)
LOC110495808 psde coding downstream 57426 20955879 ~ 20966920 (-)
LOC110495806 LOC106574400 coding downstream 68501 20949130 ~ 20955845 (-)
LOC110495804 LOC106574399 coding downstream 76960 20900502 ~ 20947386 (-)
zgc:92027 gran coding downstream 161345 20855424 ~ 20863001 (-)
LOC100136027 NA coding upstream 46189 21070882 ~ 21073322 (-)
LOC110495813 prps2 coding upstream 50492 21075185 ~ 21088022 (-)
LOC110495814 LOC106574409 coding upstream 64660 21089235 ~ 21107524 (-)
LOC110495815 LOC106574410 coding upstream 139885 21164578 ~ 21173972 (-)
LOC118941122 LOC106610709 coding upstream 198118 21222811 ~ 21227447 (-)
G1525597 NA non-coding downstream 131999 20892069 ~ 20892347 (-)
G1525312 NA non-coding downstream 275908 20748190 ~ 20748438 (-)
G1525297 NA non-coding downstream 295194 20728920 ~ 20729152 (-)
G1525279 NA non-coding downstream 308959 20715175 ~ 20715387 (-)
G1525268 NA non-coding downstream 317265 20706677 ~ 20707081 (-)
G1525646 NA non-coding upstream 124 21024817 ~ 21025196 (-)
G1525649 NA non-coding upstream 5340 21030033 ~ 21030807 (-)
G1525650 NA non-coding upstream 6515 21031208 ~ 21031411 (-)
G1525651 NA non-coding upstream 9333 21034026 ~ 21034260 (-)
G1525653 NA non-coding upstream 14996 21039689 ~ 21040025 (-)
LOC110497093 LOC106574562 other downstream 452479 20558557 ~ 20595753 (-)
G1524755 LOC106581475 other downstream 1294278 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 1447246 19573628 ~ 19577133 (-)
G1524473 LOC106574589 other downstream 1860220 19143985 ~ 19164126 (-)
G1524311 NA other downstream 2274951 18749125 ~ 18749395 (-)
G1527230 NA other upstream 1237363 22262056 ~ 22262462 (-)
G1528018 NA other upstream 1847352 22872045 ~ 22885833 (-)
LOC110495841 LOC106574435 other upstream 2134865 23008547 ~ 23168591 (-)
LOC110495851 LOC106574449 other upstream 2456847 23479558 ~ 23541681 (-)
LOC110495852 LOC106574460 other upstream 2517913 23542411 ~ 23543631 (-)

Expression


Co-expression Network