G1525651



Basic Information


Item Value
gene id G1525651
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 21034026 ~ 21034260 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1746870
ggacagctcgggacagaggtaactcgggacagatgggtagctcagccctgagaggaagctcagcactgagaagaagctcagcactgagaagaagctcaggcaggtggttagatccggcagatcctggctggctggcggttctggaagatcctggctgactggcggatctgggagaatctggacgactggcagatctgggagaatctggacgactggcagatctgagagagtctgg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1746870 True 235 lncRNA 0.58 1 21034026 21034260
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495812 LOC106574405 coding downstream 5735 21018546 ~ 21028291 (-)
LOC110495807 LOC106574402 coding downstream 57028 20968247 ~ 20976998 (-)
LOC110495808 psde coding downstream 67106 20955879 ~ 20966920 (-)
LOC110495806 LOC106574400 coding downstream 78181 20949130 ~ 20955845 (-)
LOC110495804 LOC106574399 coding downstream 86640 20900502 ~ 20947386 (-)
LOC100136027 NA coding upstream 36622 21070882 ~ 21073322 (-)
LOC110495813 prps2 coding upstream 40925 21075185 ~ 21088022 (-)
LOC110495814 LOC106574409 coding upstream 55093 21089235 ~ 21107524 (-)
LOC110495815 LOC106574410 coding upstream 130318 21164578 ~ 21173972 (-)
LOC118941122 LOC106610709 coding upstream 188551 21222811 ~ 21227447 (-)
G1525650 NA non-coding downstream 2615 21031208 ~ 21031411 (-)
G1525649 NA non-coding downstream 3219 21030033 ~ 21030807 (-)
G1525646 NA non-coding downstream 8830 21024817 ~ 21025196 (-)
G1525645 tceanc non-coding downstream 9333 21024346 ~ 21024693 (-)
G1525597 NA non-coding downstream 141679 20892069 ~ 20892347 (-)
G1525653 NA non-coding upstream 5429 21039689 ~ 21040025 (-)
G1525654 NA non-coding upstream 6191 21040451 ~ 21040763 (-)
G1525655 NA non-coding upstream 6516 21040776 ~ 21041183 (-)
G1525657 NA non-coding upstream 8795 21043055 ~ 21043283 (-)
LOC110497093 LOC106574562 other downstream 462159 20558557 ~ 20595753 (-)
G1524755 LOC106581475 other downstream 1303958 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 1456926 19573628 ~ 19577133 (-)
G1524473 LOC106574589 other downstream 1869900 19143985 ~ 19164126 (-)
G1524311 NA other downstream 2284631 18749125 ~ 18749395 (-)
G1527230 NA other upstream 1227796 22262056 ~ 22262462 (-)
G1528018 NA other upstream 1837785 22872045 ~ 22885833 (-)
LOC110495841 LOC106574435 other upstream 2125298 23008547 ~ 23168591 (-)
LOC110495851 LOC106574449 other upstream 2447280 23479558 ~ 23541681 (-)
LOC110495852 LOC106574460 other upstream 2508346 23542411 ~ 23543631 (-)

Expression


G1525651 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1525651 Expression in each Bioproject

Bar chart with 18 bars.
G1525651 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network