G1528052



Basic Information


Item Value
gene id G1528052
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 22951561 ~ 22951775 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1749487
gaatcattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaagaaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagttcaagggggccgaatactttcgcaaggcactgtatatata

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1749487 True 215 lncRNA 0.35 1 22951561 22951775

Neighbor


gene id symbol gene type direction distance location
LOC110495837 LOC106575263 coding downstream 2871 22897949 ~ 22948690 (-)
LOC110495836 NA coding downstream 91878 22853240 ~ 22859683 (-)
LOC110495832 LOC106575264 coding downstream 204632 22741195 ~ 22746929 (-)
LOC110495831 LOC106574427 coding downstream 217380 22726121 ~ 22734181 (-)
LOC110495830 LOC106575269 coding downstream 225598 22713900 ~ 22725963 (-)
LOC110495838 LOC106574434 coding upstream 12573 22964348 ~ 22977609 (-)
LOC110495839 LOC106575259 coding upstream 46815 22998590 ~ 23007852 (-)
LOC110495841 LOC106574435 coding upstream 56772 23008547 ~ 23168591 (-)
LOC110495844 LOC106574437 coding upstream 230044 23181819 ~ 23186607 (-)
LOC110495845 LOC106574439 coding upstream 261756 23213531 ~ 23223410 (-)
G1527957 NA non-coding downstream 90722 22860614 ~ 22860839 (-)
G1527899 en1 non-coding downstream 177944 22769444 ~ 22773617 (-)
LOC110497099 NA non-coding downstream 270837 22680498 ~ 22690348 (-)
G1527852 NA non-coding downstream 271178 22680045 ~ 22680383 (-)
G1528860 NA non-coding upstream 14489 22966264 ~ 22991309 (-)
G1528876 NA non-coding upstream 40927 22992702 ~ 22992926 (-)
G1528840 NA non-coding upstream 44144 22995919 ~ 22997491 (-)
G1528841 NA non-coding upstream 46020 22997795 ~ 22998261 (-)
G1528896 NA non-coding upstream 94923 23046698 ~ 23046921 (-)
G1528018 NA other downstream 65728 22872045 ~ 22885833 (-)
G1527230 NA other downstream 689099 22262056 ~ 22262462 (-)
LOC110497093 LOC106574562 other downstream 2379694 20558557 ~ 20595753 (-)
G1524755 LOC106581475 other downstream 3221493 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 3374461 19573628 ~ 19577133 (-)
LOC110495851 LOC106574449 other upstream 529765 23479558 ~ 23541681 (-)
LOC110495852 LOC106574460 other upstream 590831 23542411 ~ 23543631 (-)
LOC110497104 LOC106574262 other upstream 1327963 24279738 ~ 24371432 (-)
G1529613 NA other upstream 1441600 24393375 ~ 24393684 (-)

Expression


G1528052 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1528052 Expression in each Bioproject

Bar chart with 21 bars.
G1528052 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network