G1528896



Basic Information


Item Value
gene id G1528896
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 23046698 ~ 23046921 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1750459
GCCTATCATCGTTTAGCTACTCTGCAGGATAGAGTCAGTGTCCCCTTAAACTCAGTCTAAATGGGGCTGAGATTACGGAAAGAGAAACAAGAGGGAGGATTAATTTGGCACTCTGGAGAGATAAAGGGATCGTCATAAATGTGATTTAATCCACATCTCCAGTTTACATCTAATTTCCACATGTAAATGCATCTACAATTAACAGCACCACTTGGAACTATTTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1750459 True 224 lncRNA 0.40 1 23046698 23046921
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495839 LOC106575259 coding downstream 38846 22998590 ~ 23007852 (-)
LOC110495838 LOC106574434 coding downstream 69089 22964348 ~ 22977609 (-)
LOC110495837 LOC106575263 coding downstream 98008 22897949 ~ 22948690 (-)
LOC110495836 NA coding downstream 187015 22853240 ~ 22859683 (-)
LOC110495832 LOC106575264 coding downstream 299769 22741195 ~ 22746929 (-)
LOC110495844 LOC106574437 coding upstream 134898 23181819 ~ 23186607 (-)
LOC110495845 LOC106574439 coding upstream 166610 23213531 ~ 23223410 (-)
LOC110495846 LOC106574440 coding upstream 202119 23249040 ~ 23265087 (-)
LOC110495850 LOC106574444 coding upstream 291836 23338757 ~ 23362793 (-)
LOC110496920 LOC106574445 coding upstream 412915 23459836 ~ 23478565 (-)
G1528841 NA non-coding downstream 48437 22997795 ~ 22998261 (-)
G1528840 NA non-coding downstream 49207 22995919 ~ 22997491 (-)
G1528876 NA non-coding downstream 53772 22992702 ~ 22992926 (-)
G1528860 NA non-coding downstream 55389 22966264 ~ 22991309 (-)
G1528052 NA non-coding downstream 94923 22951561 ~ 22951775 (-)
G1528899 NA non-coding upstream 3934 23050855 ~ 23051101 (-)
G1528903 NA non-coding upstream 15765 23062686 ~ 23062961 (-)
G1528905 NA non-coding upstream 16917 23063838 ~ 23064105 (-)
G1528906 NA non-coding upstream 17340 23064261 ~ 23064513 (-)
G1528911 NA non-coding upstream 25093 23072014 ~ 23072273 (-)
G1528018 NA other downstream 160865 22872045 ~ 22885833 (-)
G1527230 NA other downstream 784236 22262056 ~ 22262462 (-)
LOC110497093 LOC106574562 other downstream 2474831 20558557 ~ 20595753 (-)
G1524755 LOC106581475 other downstream 3316630 19722745 ~ 19730068 (-)
LOC110495764 LOC106574529 other downstream 3469598 19573628 ~ 19577133 (-)
LOC110495841 LOC106574435 other upstream 112637 23008547 ~ 23168591 (-)
LOC110495851 LOC106574449 other upstream 434619 23479558 ~ 23541681 (-)
LOC110495852 LOC106574460 other upstream 495685 23542411 ~ 23543631 (-)
LOC110497104 LOC106574262 other upstream 1232817 24279738 ~ 24371432 (-)
G1529613 NA other upstream 1346454 24393375 ~ 24393684 (-)

Expression


G1528896 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1528896 Expression in each Bioproject

Bar chart with 8 bars.
G1528896 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network