G1533579



Basic Information


Item Value
gene id G1533579
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 27539066 ~ 27579929 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1755575
ttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtgggcatgatgtgttcagggtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccag

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1755575 True 286 lncRNA 0.44 2 27539066 27579929

Neighbor


gene id symbol gene type direction distance location
LOC118941127 NA coding downstream 12619 27523859 ~ 27526447 (-)
LOC110495941 LOC100196748 coding downstream 143726 27388709 ~ 27395340 (-)
LOC110495938 LOC106574308 coding downstream 174702 27257486 ~ 27364364 (-)
LOC110495936 LOC106574306 coding downstream 319593 27215066 ~ 27219473 (-)
LOC110495935 fstl1 coding downstream 353618 27158978 ~ 27185448 (-)
LOC110495948 LOC106574314 coding upstream 174429 27754174 ~ 27798978 (-)
cpb2 cpb2 coding upstream 228245 27808174 ~ 27819821 (-)
LOC110496785 LOC106574363 coding upstream 259841 27839770 ~ 27914607 (-)
LOC110495957 LOC106574318 coding upstream 368849 27948778 ~ 27974405 (-)
prkag3a LOC106575098 coding upstream 394879 27974808 ~ 27982705 (-)
G1533563 NA non-coding downstream 62519 27476285 ~ 27476547 (-)
G1533549 LOC106575085 non-coding downstream 63178 27475296 ~ 27475888 (-)
G1533550 LOC106574310 non-coding downstream 89920 27448536 ~ 27449146 (-)
G1533477 NA non-coding downstream 199373 27339456 ~ 27339693 (-)
G1533473 NA non-coding downstream 206232 27332563 ~ 27332834 (-)
G1533679 NA non-coding upstream 74283 27654212 ~ 27654522 (-)
G1533680 NA non-coding upstream 74881 27654810 ~ 27655059 (-)
G1533685 NA non-coding upstream 78613 27658542 ~ 27658742 (-)
G1533686 NA non-coding upstream 79067 27658996 ~ 27659277 (-)
G1533722 NA non-coding upstream 132657 27712586 ~ 27712992 (-)
G1533378 NA other downstream 349517 27187622 ~ 27189549 (-)
G1531236 NA other downstream 1830192 25696539 ~ 25708874 (-)
LOC110495915 NA other downstream 1965395 25571910 ~ 25574981 (-)
G1531142 NA other downstream 2015886 25519421 ~ 25523180 (-)
G1530967 LOC106574270 other downstream 2388072 25150068 ~ 25150994 (-)
LOC110495955 LOC106574324 other upstream 455035 27995381 ~ 28092196 (-)
LOC110495963 LOC106574327 other upstream 771449 28241494 ~ 28368147 (-)
G1536703 NA other upstream 2704443 30284372 ~ 30284762 (-)

Expression


G1533579 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1533579 Expression in each Bioproject

Bar chart with 11 bars.
G1533579 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.

Co-expression Network