G1537226



Basic Information


Item Value
gene id G1537226
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 30763055 ~ 30763335 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1759466
catatgtacacttcaacaatgacagacaaaatgagagaaaaaaatccagaaaatcacatcataggatttttttatgaatttatttgcaaattatagtggaaaataagtatttggtcaccaacaaacaagcaagatttctggctctcacagacctgtaacttcttctttaataggctcctctgtcctccactcgttacctgtattaatggcacctgtttgaacttgttatcagtataaaagacacctgtccacaacctcaaacagtcacactccaaactcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1759466 True 281 lncRNA 0.36 1 30763055 30763335

Neighbor


gene id symbol gene type direction distance location
LOC110496795 LOC106588160 coding upstream 158 30760567 ~ 30762897 (+)
LOC110495985 LOC106588159 coding upstream 13368 30726807 ~ 30749687 (+)
LOC110496792 cars2 coding upstream 223535 30535014 ~ 30539520 (+)
LOC118940974 LOC108266561 coding upstream 243613 30518620 ~ 30519442 (+)
cckbra LOC106575124 coding upstream 508151 30233691 ~ 30254904 (+)
znf687b LOC106588162 coding downstream 3803 30767138 ~ 30776858 (+)
LOC110495991 cssa27h1orf43 coding downstream 140689 30904024 ~ 30908524 (+)
LOC110495995 she coding downstream 253191 31016526 ~ 31033736 (+)
LOC110496000 LOC106570108 coding downstream 353579 31116914 ~ 31126108 (+)
LOC110496001 NA coding downstream 379790 31143125 ~ 31159895 (+)
G1537216 NA non-coding upstream 19803 30742711 ~ 30743252 (+)
G1537208 NA non-coding upstream 42887 30719926 ~ 30720168 (+)
G1537206 NA non-coding upstream 44877 30717939 ~ 30718178 (+)
G1537193 NA non-coding upstream 58744 30703971 ~ 30704311 (+)
G1537171 NA non-coding upstream 72174 30690347 ~ 30690881 (+)
G1537273 NA non-coding downstream 91714 30855049 ~ 30856645 (+)
G1537314 NA non-coding downstream 191771 30955106 ~ 30965748 (+)
G1537364 NA non-coding downstream 262673 31026008 ~ 31026210 (+)
G1537366 NA non-coding downstream 266143 31029478 ~ 31029683 (+)
G1537367 NA non-coding downstream 266399 31029734 ~ 31029941 (+)
G1536720 NA other upstream 465709 30297131 ~ 30297346 (+)
G1534495 NA other upstream 1949952 28812829 ~ 28813103 (+)
G1534488 LOC106574337 other upstream 1958382 28804028 ~ 28804673 (+)
LOC110495972 NA other upstream 2027827 28732589 ~ 28735229 (+)
G1533121 LOC106574322 other upstream 2724579 27974813 ~ 28038476 (+)
G1537251 NA other downstream 59173 30822508 ~ 30828046 (+)
LOC110496006 LOC106588175 other downstream 805556 31568375 ~ 31572239 (+)
LOC110496008 LOC106588176 other downstream 814832 31578096 ~ 31580320 (+)
G1538208 LOC106588182 other downstream 990375 31753710 ~ 31754191 (+)
G1539641 NA other downstream 2256893 33020228 ~ 33020544 (+)

Expression


G1537226 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1537226 Expression in each Bioproject

Bar chart with 20 bars.
G1537226 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network