G1538382



Basic Information


Item Value
gene id G1538382
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 32080249 ~ 32080726 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1760742
gaggagcctcttaaagaagaagttacaggtctgtgagagccagaaatattgcttgtttgtaggtgaccaaatacttattttccaccataatttgcaaataaattcataaaaaatcctacaatgtgattttctggatgtttttttctcattttgtctgtcatagttgaagtgtacctatgatgaaaattacaggcctctcatctttttaagtgggagaacatgcacaattggtggctgactaaatactttttttgccccactgtatatccacagtaaaacaagtcctatatcgacataacctgaaaggaagaagccactgctccaaaaccgccataataaagccaaactacggtttgcaaagattgtactttttggagaaatgtcctctggtctgatgaaacaaaaatagaactgtttggccataatgaccatcgttatgtttggaggaaaaaggggaggcttgcaagctgaagaacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1760742 True 478 lncRNA 0.38 1 32080249 32080726
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118941132 NA coding upstream 15437 32058052 ~ 32064812 (+)
LOC110496023 LOC106588191 coding upstream 59410 32008229 ~ 32020839 (+)
LOC110496022 LOC106588190 coding upstream 72298 31985755 ~ 32007951 (+)
LOC110496020 LOC106588189 coding upstream 127708 31924273 ~ 31952541 (+)
LOC110496019 LOC106588188 coding upstream 160826 31881946 ~ 31919423 (+)
LOC110496027 LOC106588195 coding downstream 260983 32341709 ~ 32351799 (+)
LOC110496028 NA coding downstream 271329 32352055 ~ 32361876 (+)
LOC118941135 NA coding downstream 493230 32573956 ~ 32659643 (+)
LOC110496032 LOC106588200 coding downstream 639623 32720349 ~ 32964969 (+)
LOC110496033 LOC106588201 coding downstream 913808 32994534 ~ 33050381 (+)
G1538336 NA non-coding upstream 919 32025784 ~ 32079330 (+)
G1538342 NA non-coding upstream 88181 31991022 ~ 31992068 (+)
G1538326 NA non-coding upstream 97215 31982609 ~ 31983034 (+)
G1538330 NA non-coding upstream 100786 31979230 ~ 31979463 (+)
G1538323 NA non-coding upstream 109493 31970502 ~ 31970756 (+)
G1538974 NA non-coding downstream 169461 32250187 ~ 32250417 (+)
G1539280 NA non-coding downstream 425283 32506009 ~ 32506227 (+)
G1539310 NA non-coding downstream 450364 32531090 ~ 32531297 (+)
G1539311 NA non-coding downstream 452095 32532821 ~ 32533074 (+)
G1539325 NA non-coding downstream 463585 32544311 ~ 32544531 (+)
G1538208 LOC106588182 other upstream 326058 31753710 ~ 31754191 (+)
LOC110496008 LOC106588176 other upstream 499929 31578096 ~ 31580320 (+)
LOC110496006 LOC106588175 other upstream 508010 31568375 ~ 31572239 (+)
G1537251 NA other upstream 1252203 30822508 ~ 30828046 (+)
G1536720 NA other upstream 1782903 30297131 ~ 30297346 (+)
G1539641 NA other downstream 939502 33020228 ~ 33020544 (+)
G1539671 LOC106582599 other downstream 978264 33058990 ~ 33059857 (+)
LOC110496797 LOC106570068 other downstream 1374834 33455560 ~ 33458964 (+)
G1540551 NA other downstream 1408611 33489337 ~ 33491121 (+)
LOC110496043 LOC106588212 other downstream 1454550 33535229 ~ 33537569 (+)

Expression


G1538382 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1538382 Expression in each Bioproject

Bar chart with 20 bars.
G1538382 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network