G1540886


Basic Information

Item Value
gene id G1540886
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 33908231 ~ 33908628 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1763440
ggcagctcgggactgaggcagctcgggactgaggggaagctcaggcaggttgatgaatctaccagatcctggtcgaccggcagatctggaagagtctggtcgaccggcagatctggaagagtctggtcgaccggcagatctggaagagtctggtcgaccggcagatctggaagagtctggtcgaccggcagatctggaagagtctggtc

Function

NR:

description
PREDICTED: mediator of RNA polymerase II transcription subunit 15-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1763440 True 209 lncRNA 0.60 2 33908231 33908628

Neighbor

gene id symbol gene type direction distance location
LOC110496043 LOC106588212 coding upstream 370662 33535229 ~ 33537569 (+)
LOC100136630 LOC106570065 coding upstream 395805 33508836 ~ 33512426 (+)
LOC110496055 LOC106588221 coding downstream 30054 33938682 ~ 34059960 (+)
LOC110496056 dpy19l4 coding downstream 171480 34080108 ~ 34088560 (+)
ints8 ints8 coding downstream 183619 34092247 ~ 34116282 (+)
LOC110496058 LOC106588349 coding downstream 218564 34127192 ~ 34133734 (+)
trhrb LOC106588145 coding downstream 352684 34261312 ~ 34265470 (+)
G1540851 NA non-coding upstream 45079 33862239 ~ 33863152 (+)
G1540819 NA non-coding upstream 91767 33816173 ~ 33816464 (+)
G1540729 NA non-coding upstream 214953 33690250 ~ 33693278 (+)
G1540722 NA non-coding upstream 269064 33638635 ~ 33639167 (+)
G1540721 NA non-coding upstream 270735 33636369 ~ 33637496 (+)
G1540967 NA non-coding downstream 122240 34030868 ~ 34031208 (+)
G1540976 NA non-coding downstream 134505 34043133 ~ 34045680 (+)
G1540994 NA non-coding downstream 166500 34075128 ~ 34075581 (+)
G1541243 NA non-coding downstream 212088 34120716 ~ 34120977 (+)
G1541268 NA non-coding downstream 217042 34125670 ~ 34125991 (+)
G1540551 NA other upstream 417110 33489337 ~ 33491121 (+)
LOC110496797 LOC106570068 other upstream 449807 33455560 ~ 33458964 (+)
G1539671 LOC106582599 other upstream 848374 33058990 ~ 33059857 (+)
G1539641 NA other upstream 887687 33020228 ~ 33020544 (+)
G1540996 NA other downstream 170090 34078718 ~ 34079074 (+)
mbpa LOC106588233 other downstream 974886 34883492 ~ 34898413 (+)
G1541989 NA other downstream 1373975 35282603 ~ 35283706 (+)
G1542037 LOC106588244 other downstream 1466616 35373871 ~ 35386463 (+)

Expression


Co-expression Network