G1541207



Basic Information


Item Value
gene id G1541207
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 34031497 ~ 34033219 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1763778
ttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagttcaagggggccgaatactttcacaaggcactgtatatccacagtaaaacaaatcctatatcaacataacctgaaagggcgctcagcaaggaagaagccactactccaaaaccgacataaaaaagccagactacaatttccatctgcacatggggacaaagatcatacttgttggagaaatgtcctctggtctgatgaaacaaaaatagaactgtttggtcataatgaccattgttatgtttggaggaaaaagggggaggcttgcaagccgaagaacaccatcccaaccgtgaagcacgggggtggcagcatcatgttgtggtggtgctttgctgcaggagggactggtgcacttcacaaaatggatggcatcatgaggcaggaaaattatgtggatatattgaagcaacatctcaagacatcagttaaagcttagttgaaaatgggtcttccaaatggacaatgaccccaagcatacttccaaagttgtggcaaaatggcttaaggacaacaaagtcaaggtattggagtggccatcacaaagccctgaccgcaatcctatagaaaatttgtgggcagaactg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1763778 True 687 lncRNA 0.43 2 34031497 34033219
Loading

Neighbor


gene id symbol gene type direction distance location
lrp12 lrp12 coding downstream 164066 33828341 ~ 33867431 (-)
vps72a vps72 coding downstream 218196 33783934 ~ 33813301 (-)
LOC110496051 LOC106588219 coding downstream 284712 33697163 ~ 33746785 (-)
LOC110496050 csnk2b coding downstream 335588 33692392 ~ 33695909 (-)
LOC110496049 LOC106588217 coding downstream 357193 33657641 ~ 33674304 (-)
gdf6b gdf6 coding upstream 145814 34179033 ~ 34183891 (-)
LOC118940975 LOC106611608 coding upstream 202169 34235388 ~ 34237566 (-)
fbxl6 fbxl6 coding upstream 562012 34595231 ~ 34619367 (-)
nfatc1 LOC106588230 coding upstream 611897 34645116 ~ 34704821 (-)
atp9b atp9b coding upstream 704608 34735374 ~ 34794929 (-)
G1541115 NA non-coding downstream 92494 33875250 ~ 33939003 (-)
G1541007 NA non-coding downstream 374553 33656725 ~ 33656944 (-)
G1540717 NA non-coding downstream 404257 33626979 ~ 33627240 (-)
G1540633 NA non-coding downstream 407710 33623547 ~ 33623787 (-)
G1541225 NA non-coding upstream 36748 34069967 ~ 34070184 (-)
G1541230 NA non-coding upstream 46194 34079413 ~ 34080134 (-)
G1541248 NA non-coding upstream 84849 34118068 ~ 34118453 (-)
G1541259 NA non-coding upstream 86656 34119875 ~ 34120592 (-)
G1541260 NA non-coding upstream 87430 34120649 ~ 34121034 (-)
LOC110496048 LOC106588215 other downstream 420604 33602474 ~ 33610948 (-)
G1540473 LOC106581475 other downstream 639745 33391339 ~ 33391752 (-)
G1540148 NA other downstream 1094928 32899578 ~ 32936569 (-)
G1539348 NA other downstream 1469377 32561726 ~ 32562120 (-)
G1541318 NA other upstream 128708 34161927 ~ 34162458 (-)
G1542988 sast other upstream 1104418 35137637 ~ 35138554 (-)
LOC110496081 LOC106588241 other upstream 1142087 35151351 ~ 35203984 (-)
LOC110496085 NA other upstream 1313676 35346895 ~ 35351655 (-)

Expression


G1541207 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1541207 Expression in each Bioproject

Bar chart with 21 bars.
G1541207 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network