G1543364



Basic Information


Item Value
gene id G1543364
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 36042400 ~ 36043159 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1766191
cactctccttcttggtcaaatagcccttacccagtcttgaggtgtgttttgggtcattgtcctgttgaaaaacaaatgatagtgggactaagcgcaaaccagatgggatggcatattactgcaaaatgctgtggtagccatgctggtttagtgcgcctcgaattctaaataaatcactgactgtcaccagcaaagcacccccacacctcctcctccatgcttgacggtgggaaccacacatgcggagatcatccggtgtctgttacttgaactctgaagcatttatttaggctgcaatttctgaggctggtaactccaaagaacttatcctctgcagcagaagtaactctgggtcttcctttccagtggcggtgctcatgagagccagtttcatcatattgcttgatggtttttgtgactgcacttgaagaaacattcaaagttcttgaaattttacagattactttaagacatgaatgtcagtcaatgatggactgttgtttctcttcgctcatttgagctgttcttaccataatatggacttggtcttctaccaaatagggctatcttctgtataccacccctaccttgtcacaacacaactgattggctcaaacgcattaagaaggaaagaaattccacaaattaacaacctgttaattgaaatgcattccaggtgactacctcatgaggctggttgagagaatgccaagagtgtgcaaagctgtcatcaaggcaaagggtggctactttgaagaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1766191 True 760 lncRNA 0.43 1 36042400 36043159

Neighbor


gene id symbol gene type direction distance location
LOC110496104 LOC106588515 coding downstream 61452 35975293 ~ 35980948 (-)
LOC110496103 LOC106588514 coding downstream 70683 35918293 ~ 35971717 (-)
LOC110496102 LOC106570058 coding downstream 124261 35912005 ~ 35918139 (-)
LOC110496100 LOC106588520 coding downstream 159936 35871685 ~ 35882464 (-)
LOC110496099 LOC106588248 coding downstream 225730 35808966 ~ 35816670 (-)
LOC110496109 LOC106588511 coding upstream 28536 36068180 ~ 36077299 (-)
LOC110496110 LOC106588509 coding upstream 40975 36084134 ~ 36100917 (-)
ext1b LOC103365060 coding upstream 152976 36196135 ~ 36308398 (-)
samd12 LOC106588503 coding upstream 293356 36336515 ~ 36461461 (-)
abrab LOC106570048 coding upstream 421411 36464570 ~ 36465358 (-)
G1543363 NA non-coding downstream 861 36041134 ~ 36041539 (-)
G1543360 NA non-coding downstream 4140 36038049 ~ 36038260 (-)
G1543343 NA non-coding downstream 7562 36007637 ~ 36034838 (-)
G1543321 NA non-coding downstream 69545 35971758 ~ 35972855 (-)
G1543297 NA non-coding downstream 156506 35885664 ~ 35885894 (-)
G1543390 NA non-coding upstream 61120 36104279 ~ 36104504 (-)
G1543428 NA non-coding upstream 149589 36192748 ~ 36193845 (-)
G1543605 NA non-coding upstream 272680 36315839 ~ 36316263 (-)
G1543346 LOC106588513 other downstream 29714 36010987 ~ 36012686 (-)
G1543128 LOC106588245 other downstream 538243 35452618 ~ 35504157 (-)
LOC118941140 NA other downstream 545418 35492995 ~ 35499681 (-)
LOC110496085 NA other downstream 692738 35346895 ~ 35351655 (-)
LOC110496081 LOC106588241 other downstream 862372 35151351 ~ 35203984 (-)
G1544806 NA other upstream 1258349 37301508 ~ 37302174 (-)
ppt1 LOC106588481 other upstream 1878996 37922153 ~ 37930745 (-)
LOC110496154 LOC106588291 other upstream 2104431 38121576 ~ 38152320 (-)
G1546053 NA other upstream 2122091 38165250 ~ 38214049 (-)
LOC110496167 LOC106588455 other upstream 2516490 38557052 ~ 38563365 (-)

Expression


G1543364 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1543364 Expression in each Bioproject

Bar chart with 21 bars.
G1543364 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network