G1544007



Basic Information


Item Value
gene id G1544007
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 36764294 ~ 36765233 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1766867
AGGCAGTTTGGGCAAATGCCCAATGGGCCGGTCCATCGTTAGCTTAGTGGGCCGGTCTAAAAGGTTGTTGTGTTCCCTCACCTCAGTTCTGACTGGCTTCCAGGGCGTTTCCCCAGGCAGGTCTTCTCTGGGCGTGTCTGTCTCCACTCTGGGAGTGAAGTCTTTGGTGGAGTCCTGGGTGGGTTCTGCTTTGGGCACAATGTACAACGTGTTCACGGTCACCGCCTCCTCGATCACCTCCTCAGCAGTGCCTGATCCTGACCCCGAGTTAAAGTCGTCGTCATCCTCAGGGTAGTAACCCCCGGACCCTGTGTCGTCAATGAAAAGTTCATCCACTTCGGAGGACGACTTGGCCGCGTCCGCTATCTGAAATGGAGAACAACAGAAATCTAGACAAAGTACTGGGCATTTAGACTGTTCCCGAGGCCACTTTTCAATGCGCAAGTCCAACATAACTTTCTTATAGTCACCACTTTTGTCTTTGAAATACTTCTAGCAGTGAACACATTTCTGGATACCACGATCTGATTGTTTGGTAGAAAGC

Function


NR:

description
syndecan-2-A-like

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1766867 True 544 TUCP 0.51 2 36764294 36765233
Loading

Neighbor


gene id symbol gene type direction distance location
med30 LOC106570051 coding upstream 570444 36135094 ~ 36197363 (+)
LOC110496805 LOC106588507 coding upstream 605903 36147703 ~ 36158391 (+)
LOC110496111 LOC106588509 coding upstream 679528 36076661 ~ 36091606 (+)
LOC110496108 LOC106588512 coding upstream 696187 36023893 ~ 36068107 (+)
LOC110496106 LOC106588513 coding upstream 742521 35999199 ~ 36021773 (+)
ext1c LOC106588496 coding downstream 89895 36855128 ~ 36932244 (+)
trnaa-ugc-136 NA coding downstream 171225 36936458 ~ 36936527 (+)
LOC110496123 NA coding downstream 201146 36966379 ~ 36967984 (+)
LOC110496127 NA coding downstream 250527 37015760 ~ 37022862 (+)
LOC110496809 LOC106588491 coding downstream 367356 37132589 ~ 37141720 (+)
G1544005 NA non-coding upstream 3056 36667629 ~ 36761238 (+)
G1543857 NA non-coding upstream 196017 36568063 ~ 36568277 (+)
G1543741 NA non-coding upstream 215627 36487474 ~ 36548667 (+)
G1543735 NA non-coding upstream 281856 36482219 ~ 36482438 (+)
G1543719 NA non-coding upstream 291549 36472108 ~ 36472745 (+)
G1544063 NA non-coding downstream 28 36765261 ~ 36765613 (+)
G1544064 NA non-coding downstream 1555 36766788 ~ 36767006 (+)
G1544066 NA non-coding downstream 7490 36772723 ~ 36772947 (+)
G1544073 NA non-coding downstream 21470 36786703 ~ 36786985 (+)
G1544074 NA non-coding downstream 22184 36787417 ~ 36787650 (+)
G1542324 LOC106588514 other upstream 800589 35961201 ~ 35963705 (+)
G1542282 NA other upstream 893736 35870237 ~ 35870558 (+)
G1542262 NA other upstream 918098 35845814 ~ 35846196 (+)
G1542254 yo84 other upstream 926751 35836677 ~ 35837543 (+)
G1544137 NA other downstream 97690 36862923 ~ 36863183 (+)
G1544455 NA other downstream 290750 37055983 ~ 37056487 (+)
LOC110496158 LOC106588463 other downstream 1428019 38193174 ~ 38204538 (+)
G1545533 LOC104965079 other downstream 1909794 38675027 ~ 38676004 (+)
LOC110496176 LOC106588451 other downstream 1925205 38677975 ~ 38696088 (+)

Expression


G1544007 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1544007 Expression in each Bioproject

Bar chart with 14 bars.
G1544007 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network