G1544135



Basic Information


Item Value
gene id G1544135
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 36861339 ~ 36861544 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1766997
CTCCCAGCGCTATGCCATCTCCCAGCGCTATGCCATCTCCCAGCGCTATGCCATCTCCCAGCGCTATGCCATCTCCCAGCGCTATGCCATCTCAAAGCGCTATGCCATCTATTGCTACACTGCTGTTTTCATTTACACAGTACAACAAACAGGATGGCGATTGGGGTTCTATCGTTGCCTTGCATAATGTTGACAGTTGGTAATGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1766997 True 206 lncRNA 0.51 1 36861339 36861544
Loading

Neighbor


gene id symbol gene type direction distance location
med30 LOC106570051 coding upstream 667489 36135094 ~ 36197363 (+)
LOC110496805 LOC106588507 coding upstream 702948 36147703 ~ 36158391 (+)
LOC110496111 LOC106588509 coding upstream 776573 36076661 ~ 36091606 (+)
LOC110496108 LOC106588512 coding upstream 793232 36023893 ~ 36068107 (+)
LOC110496106 LOC106588513 coding upstream 839566 35999199 ~ 36021773 (+)
trnaa-ugc-136 NA coding downstream 74914 36936458 ~ 36936527 (+)
LOC110496123 NA coding downstream 104835 36966379 ~ 36967984 (+)
LOC110496127 NA coding downstream 154216 37015760 ~ 37022862 (+)
LOC110496809 LOC106588491 coding downstream 271045 37132589 ~ 37141720 (+)
LOC110496810 LOC106588469 coding downstream 604247 37465791 ~ 37720841 (+)
G1544129 NA non-coding upstream 11638 36849463 ~ 36849701 (+)
G1544123 NA non-coding upstream 18640 36842459 ~ 36842699 (+)
G1544118 NA non-coding upstream 24426 36836651 ~ 36836913 (+)
G1544102 NA non-coding upstream 43780 36817349 ~ 36817559 (+)
G1544101 NA non-coding upstream 46433 36814674 ~ 36814906 (+)
G1544139 NA non-coding downstream 6355 36867899 ~ 36868116 (+)
G1544142 NA non-coding downstream 12935 36874479 ~ 36874691 (+)
ext1c LOC106588496 non-coding downstream 69767 36855128 ~ 36932244 (+)
G1544370 NA non-coding downstream 83212 36944756 ~ 36945009 (+)
G1544377 NA non-coding downstream 88088 36949632 ~ 36949845 (+)
G1544007 NA other upstream 96106 36764294 ~ 36765233 (+)
G1542324 LOC106588514 other upstream 897634 35961201 ~ 35963705 (+)
G1542282 NA other upstream 990781 35870237 ~ 35870558 (+)
G1542262 NA other upstream 1015143 35845814 ~ 35846196 (+)
G1544137 NA other downstream 1379 36862923 ~ 36863183 (+)
G1544455 NA other downstream 194439 37055983 ~ 37056487 (+)
LOC110496158 LOC106588463 other downstream 1331708 38193174 ~ 38204538 (+)
G1545533 LOC104965079 other downstream 1813483 38675027 ~ 38676004 (+)
LOC110496176 LOC106588451 other downstream 1828894 38677975 ~ 38696088 (+)

Expression


G1544135 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1544135 Expression in each Bioproject

Bar chart with 7 bars.
G1544135 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network