G1545533 (LOC104965079)



Basic Information


Item Value
gene id G1545533
gene name LOC104965079
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 38675027 ~ 38676004 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1768508
GCTTTTATGGCCAGTTGCCACAGCCCTAAGGCCCCCTGTGGCGATGGATATGCATCTTGCGGCTGAGGGTGCGGGCCAGCCGGTCCACGGTGGTGCCGATGTGGCCAAGCTCTTTGCTGGAGACGAGGCCGTCAATGTTTCCGCTGTACCACAGCACCCAGCCCCCCAGGGACATGAGCACGAACAGTGCTCCTGTGTACACCAGGAGGTCCCCAAAGTCCCTGCCTTTGATATTCAGAGGGACAAAGACTCCCACCAGCAAGGCGGTGCCACCCAGCAAGTCCATCAGCACTGCAAAGGCCAGGGCCAGTTTACAGTGGGACAGGCCATCACAGAGCCCCATGGTCACACCTACCTGGACACGTTGTGTAATCTTCCGGAATTCGATCCCAC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1768508 True 393 TUCP 0.59 2 38675027 38676004
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110496172 LOC106588452 coding upstream 29402 38632507 ~ 38645625 (+)
LOC110496171 LOC106588453 coding upstream 43333 38617802 ~ 38631694 (+)
si:ch211-171h4.3 LOC106588290 coding upstream 77669 38593275 ~ 38597358 (+)
LOC110496168 mag coding upstream 102697 38563969 ~ 38572330 (+)
LOC110496162 LOC106588459 coding upstream 178560 38482660 ~ 38496467 (+)
LOC110496176 LOC106588451 coding downstream 1971 38677975 ~ 38696088 (+)
cnot3b LOC106588450 coding downstream 21117 38697121 ~ 38713314 (+)
LOC110496812 LOC106588449 coding downstream 40481 38716485 ~ 38730617 (+)
LOC110496178 LOC106588448 coding downstream 78061 38754065 ~ 38773708 (+)
LOC110496179 LOC106588446 coding downstream 100244 38776248 ~ 38787830 (+)
G1545493 NA non-coding upstream 69534 38605268 ~ 38605493 (+)
G1545276 NA non-coding upstream 151194 38522599 ~ 38523833 (+)
G1545436 NA non-coding upstream 158095 38502789 ~ 38516932 (+)
G1545432 NA non-coding upstream 166225 38495407 ~ 38508802 (+)
G1545419 NA non-coding upstream 237340 38435118 ~ 38437687 (+)
G1545508 NA non-coding downstream 6659 38682663 ~ 38685107 (+)
G1545537 NA non-coding downstream 11256 38687260 ~ 38687551 (+)
G1545558 NA non-coding downstream 76560 38752564 ~ 38752793 (+)
LOC110496158 LOC106588463 other upstream 470572 38193174 ~ 38204538 (+)
G1544455 NA other upstream 1618540 37055983 ~ 37056487 (+)
G1544137 NA other upstream 1811844 36862923 ~ 36863183 (+)
G1544007 NA other upstream 1909794 36764294 ~ 36765233 (+)
LOC110496111 LOC106588509 other upstream 2583421 36076661 ~ 36091606 (+)
G1546605 LOC106588434 other downstream 440484 39116488 ~ 39120019 (+)
G1546641 NA other downstream 457115 39133119 ~ 39146252 (+)
G1546713 LOC106569985 other downstream 682407 39358411 ~ 39372481 (+)
G1546817 LOC106588418 other downstream 791450 39467454 ~ 39469365 (+)

Expression


G1545533(LOC104965079) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1545533(LOC104965079) Expression in each Bioproject

Bar chart with 9 bars.
G1545533(LOC104965079) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network