G1547880



Basic Information


Item Value
gene id G1547880
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 40520287 ~ 40520591 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1771183
gttaatgcaagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctaactaacaattccaaaactactgtcttatacacaatgtaaggggataaagaatatgtacataaggatatatgaatgagtgatggtacagagcagcataggcaagatacagtagatggtatcgagtacagtatatacatatgagatgagtatgtaaacaaggtggcatagttaaagtggctagtgatgcatgtattacataaggatgcagtcgatgatatagagtacagtatatac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1771183 True 305 lncRNA 0.36 1 40520287 40520591
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110496243 LOC106588384 coding upstream 19543 40487954 ~ 40500744 (+)
vps52 vps52 coding upstream 35947 40408575 ~ 40517763 (+)
LOC110496235 LOC106588392 coding upstream 56078 40460473 ~ 40464209 (+)
LOC118941159 NA coding upstream 201453 40316169 ~ 40318834 (+)
LOC110496233 brd2 coding upstream 210721 40297053 ~ 40309566 (+)
LOC110496240 LOC106588375 coding downstream 5294 40525885 ~ 40542149 (+)
LOC110496237 LOC105028059 coding downstream 42379 40562970 ~ 40601009 (+)
LOC110496242 LOC106588382 coding downstream 86699 40607290 ~ 40611845 (+)
LOC110496244 LOC106588385 coding downstream 91305 40611896 ~ 40619490 (+)
LOC118941160 NA coding downstream 103263 40623854 ~ 40626108 (+)
G1547816 NA non-coding upstream 48612 40392626 ~ 40471675 (+)
G1547834 rps18 non-coding upstream 48705 40469109 ~ 40471582 (+)
G1547815 NA non-coding upstream 99891 40417407 ~ 40420396 (+)
G1547840 NA non-coding upstream 104438 40414796 ~ 40415849 (+)
G1547888 NA non-coding downstream 23884 40544475 ~ 40544828 (+)
G1547910 NA non-coding downstream 41728 40562319 ~ 40562524 (+)
G1547911 NA non-coding downstream 42939 40563530 ~ 40563743 (+)
G1547926 NA non-coding downstream 61369 40581960 ~ 40582164 (+)
G1547817 NA other upstream 90767 40427108 ~ 40429520 (+)
G1547788 NA other upstream 193106 40326475 ~ 40327181 (+)
G1547743 NA other upstream 317829 40201909 ~ 40202458 (+)
LOC110496221 LOC106588406 other upstream 413441 40103731 ~ 40110006 (+)
G1547904 NA other downstream 187427 40708018 ~ 40717744 (+)
LOC110496251 LOC106569933 other downstream 217027 40736719 ~ 40738475 (+)
G1548171 ndufb9 other downstream 644963 41165554 ~ 41169102 (+)
G1549270 NA other downstream 1116731 41637322 ~ 41638401 (+)
LOC110496278 LOC106588345 other downstream 1147688 41667929 ~ 41713715 (+)

Expression


G1547880 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1547880 Expression in each Bioproject

Bar chart with 12 bars.
G1547880 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network