G1548627



Basic Information


Item Value
gene id G1548627
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 40760345 ~ 40760570 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1772038
TTTCAATGTAGGGAATCTTTTTGGTTTCCATACTCAATGCACTGTATTTCCTACAACAAGTGACGTGAAAGAGTCATAAGTTGTAAGCCACATACCTGTACGAGCTCCGTCTTATCAAAGTTCTTGCGGTATCTGTAGATGCTCTGACACAACAACGCATAGAGCTTCTCCAGCTGATGCACCTCATAACCCTCAGTCTTGGACACAGCTCTTTTGAGCAATTGCT

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1772038 True 226 lncRNA 0.43 1 40760345 40760570
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118941161 NA coding downstream 82268 40675469 ~ 40678077 (-)
LOC110496249 NA coding downstream 206726 40545209 ~ 40553619 (-)
LOC118941163 NA coding downstream 256867 40501665 ~ 40503478 (-)
LOC118941162 NA coding downstream 258935 40500738 ~ 40501410 (-)
LOC100653472 LOC100653472 coding downstream 272705 40485361 ~ 40487640 (-)
LOC110496253 LOC106588368 coding upstream 26257 40786827 ~ 40807771 (-)
LOC110496254 col14a1 coding upstream 54257 40814827 ~ 40901992 (-)
LOC118941164 LOC106588367 coding upstream 143186 40902519 ~ 40908744 (-)
ndufb9 ndufb9 coding upstream 404969 41165539 ~ 41169132 (-)
LOC110496267 LOC106588355 coding upstream 465115 41225685 ~ 41327540 (-)
G1548613 NA non-coding downstream 16829 40742733 ~ 40743516 (-)
G1548612 LOC106588371 non-coding downstream 19355 40736764 ~ 40740990 (-)
G1548513 NA non-coding downstream 62870 40642185 ~ 40697475 (-)
G1548512 LOC106588380 non-coding downstream 65613 40646962 ~ 40694732 (-)
G1548581 NA non-coding downstream 107103 40651342 ~ 40653242 (-)
G1548631 NA non-coding upstream 23408 40783978 ~ 40786646 (-)
G1548647 NA non-coding upstream 70795 40831365 ~ 40831747 (-)
G1548658 NA non-coding upstream 90047 40850617 ~ 40850823 (-)
G1548678 NA non-coding upstream 129022 40889592 ~ 40957871 (-)
G1548517 NA other downstream 74704 40640175 ~ 40685641 (-)
G1548367 NA other downstream 368462 40385970 ~ 40391883 (-)
LOC110496816 LOC106588265 other downstream 1071664 39642841 ~ 39688750 (-)
LOC110496208 LOC106588417 other downstream 1129247 39625771 ~ 39641803 (-)
G1546396 LOC106588446 other downstream 1972544 38776284 ~ 38787801 (-)
LOC110496277 LOC106588347 other upstream 902866 41663436 ~ 41671516 (-)
G1550177 LOC106569881 other upstream 1554716 42315286 ~ 42316079 (-)
G1550202 NA other upstream 1598578 42359148 ~ 42359628 (-)
LOC118936491 LOC106588302 other upstream 2134461 42895031 ~ 43015119 (-)

Expression


G1548627 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1548627 Expression in each Bioproject

Bar chart with 6 bars.
G1548627 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network