G1548658



Basic Information


Item Value
gene id G1548658
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 40850617 ~ 40850823 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1772069
gtggccacaccagatactgactgttacttttgattttgacccccccctttgttcagggacacattattcaatttctgttagtcacatgtctgtggaacttgttcagtttatgtctcagttgtggaatcttgttatgttcatacaaatatttacacatgttaagtttgctgaaaataaacgcagttgacatagagaggacgtttcttt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1772069 True 207 lncRNA 0.38 1 40850617 40850823
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110496253 LOC106588368 coding downstream 42846 40786827 ~ 40807771 (-)
LOC118941161 NA coding downstream 172540 40675469 ~ 40678077 (-)
LOC110496249 NA coding downstream 296998 40545209 ~ 40553619 (-)
LOC118941163 NA coding downstream 347139 40501665 ~ 40503478 (-)
LOC118941162 NA coding downstream 349207 40500738 ~ 40501410 (-)
LOC118941164 LOC106588367 coding upstream 52933 40902519 ~ 40908744 (-)
ndufb9 ndufb9 coding upstream 314716 41165539 ~ 41169132 (-)
LOC110496267 LOC106588355 coding upstream 374862 41225685 ~ 41327540 (-)
LOC110496269 LOC106588349 coding upstream 679920 41530743 ~ 41531326 (-)
LOC110496931 LOC106588283 coding upstream 681508 41532331 ~ 41533462 (-)
G1548647 NA non-coding downstream 18870 40831365 ~ 40831747 (-)
G1548631 NA non-coding downstream 63971 40783978 ~ 40786646 (-)
G1548627 NA non-coding downstream 90047 40760345 ~ 40760570 (-)
G1548613 NA non-coding downstream 107101 40742733 ~ 40743516 (-)
G1548612 LOC106588371 non-coding downstream 109627 40736764 ~ 40740990 (-)
G1548678 NA non-coding upstream 38769 40889592 ~ 40957871 (-)
G1548739 NA non-coding upstream 150292 41001115 ~ 41073864 (-)
G1548824 NA non-coding upstream 280636 41131459 ~ 41131992 (-)
G1548845 NA non-coding upstream 331243 41182066 ~ 41182287 (-)
G1548517 NA other downstream 164976 40640175 ~ 40685641 (-)
G1548367 NA other downstream 458734 40385970 ~ 40391883 (-)
LOC110496816 LOC106588265 other downstream 1161936 39642841 ~ 39688750 (-)
LOC110496208 LOC106588417 other downstream 1219519 39625771 ~ 39641803 (-)
G1546396 LOC106588446 other downstream 2062816 38776284 ~ 38787801 (-)
LOC110496277 LOC106588347 other upstream 812613 41663436 ~ 41671516 (-)
G1550177 LOC106569881 other upstream 1464463 42315286 ~ 42316079 (-)
G1550202 NA other upstream 1508325 42359148 ~ 42359628 (-)
LOC118936491 LOC106588302 other upstream 2044208 42895031 ~ 43015119 (-)

Expression


G1548658 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1548658 Expression in each Bioproject

Bar chart with 21 bars.
G1548658 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network