G1550104



Basic Information


Item Value
gene id G1550104
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 42191862 ~ 42192144 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1773667
ggggagaggtagttgtttgggctaaatgatagatgggctgtgtacaggtgcagtaatctgtgagctgctctgacagctggtgcattaagctagtgagggagataagtgtttccagtttcagagatttttgtagttcgttccagttattagcagcaaagaactggaaggagaggcggccaaaggaagaattggttttgggggtgaccagagagatatacctgctggagtgcgtgctacagattggtgctgctatggtgaccagcgagctgagataaggggggac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1773667 True 283 lncRNA 0.49 1 42191862 42192144

Neighbor


gene id symbol gene type direction distance location
LOC110496298 LOC106588323 coding downstream 59643 42105604 ~ 42132219 (-)
LOC100135825 tyr coding downstream 98662 42088179 ~ 42093200 (-)
LOC110496296 LOC106588326 coding downstream 116430 42056387 ~ 42075432 (-)
LOC110496294 LOC106588328 coding downstream 135683 42048101 ~ 42056179 (-)
LOC110496293 tcpg coding downstream 145229 42037274 ~ 42046633 (-)
LOC110496299 LOC106569884 coding upstream 87381 42279525 ~ 42286932 (-)
LOC110496300 LOC106588320 coding upstream 99523 42291667 ~ 42297772 (-)
stom stom coding upstream 248201 42440345 ~ 42451777 (-)
LOC110496307 LOC106588314 coding upstream 347183 42539327 ~ 42542965 (-)
LOC110496309 thap7 coding upstream 363580 42555724 ~ 42588918 (-)
G1550073 NA non-coding downstream 22536 42169066 ~ 42169326 (-)
G1549996 NA non-coding downstream 87322 42103892 ~ 42104540 (-)
G1549997 NA non-coding downstream 88960 42102448 ~ 42102902 (-)
G1550020 NA non-coding downstream 198756 41992853 ~ 41993106 (-)
G1550157 NA non-coding upstream 78136 42270280 ~ 42270895 (-)
G1550124 NA non-coding upstream 97721 42289865 ~ 42291075 (-)
G1550170 NA non-coding upstream 115333 42307477 ~ 42307699 (-)
G1550175 NA non-coding upstream 121607 42313751 ~ 42314044 (-)
LOC110496277 LOC106588347 other downstream 520348 41663436 ~ 41671516 (-)
LOC118941164 LOC106588367 other downstream 1283237 40902519 ~ 40908744 (-)
G1548517 NA other downstream 1506221 40640175 ~ 40685641 (-)
G1548367 NA other downstream 1799979 40385970 ~ 40391883 (-)
LOC110496816 LOC106588265 other downstream 2503181 39642841 ~ 39688750 (-)
G1550177 LOC106569881 other upstream 123142 42315286 ~ 42316079 (-)
G1550202 NA other upstream 167004 42359148 ~ 42359628 (-)
LOC118936491 LOC106588302 other upstream 702887 42895031 ~ 43015119 (-)
LOC118940987 NA other upstream 1438862 43624763 ~ 43668196 (-)
G1552768 LOC106588550 other upstream 2628619 44820763 ~ 44828808 (-)

Expression


G1550104 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1550104 Expression in each Bioproject

Bar chart with 16 bars.
G1550104 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network