G1550170



Basic Information


Item Value
gene id G1550170
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 42307477 ~ 42307699 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1773741
caacaatgcagttttaagaaaatacctacaaaaaaatgtaagagataagaataacaaataattaaagagcagcagtaagtaacaatagctaggctatatacagagtcaatgtgcgggggcactggtgtcaaggtaattgaggtaatatgtacatgtaggtagagttattaaagtgactatacatagataaaaaacagagagtagcagcagcgtagaaggggag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1773741 True 223 lncRNA 0.35 1 42307477 42307699
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110496300 LOC106588320 coding downstream 9705 42291667 ~ 42297772 (-)
LOC110496299 LOC106569884 coding downstream 20545 42279525 ~ 42286932 (-)
LOC110496297 LOC106588322 coding downstream 39387 42145158 ~ 42268090 (-)
LOC110496298 LOC106588323 coding downstream 175258 42105604 ~ 42132219 (-)
LOC100135825 tyr coding downstream 214277 42088179 ~ 42093200 (-)
stom stom coding upstream 132646 42440345 ~ 42451777 (-)
LOC110496307 LOC106588314 coding upstream 231628 42539327 ~ 42542965 (-)
LOC110496309 thap7 coding upstream 248025 42555724 ~ 42588918 (-)
LOC110496310 LOC106588521 coding upstream 310375 42618074 ~ 42624506 (-)
LOC110496315 NA coding upstream 480821 42788520 ~ 42804428 (-)
G1550124 NA non-coding downstream 16402 42289865 ~ 42291075 (-)
G1550157 NA non-coding downstream 36582 42270280 ~ 42270895 (-)
G1550104 NA non-coding downstream 115333 42191862 ~ 42192144 (-)
G1550073 NA non-coding downstream 138151 42169066 ~ 42169326 (-)
G1550175 NA non-coding upstream 6052 42313751 ~ 42314044 (-)
G1550178 NA non-coding upstream 10099 42317798 ~ 42318049 (-)
G1550181 NA non-coding upstream 14972 42322671 ~ 42323020 (-)
G1550182 NA non-coding upstream 19739 42327438 ~ 42327775 (-)
G1550183 NA non-coding upstream 20284 42327983 ~ 42328243 (-)
LOC110496277 LOC106588347 other downstream 635963 41663436 ~ 41671516 (-)
LOC118941164 LOC106588367 other downstream 1398852 40902519 ~ 40908744 (-)
G1548517 NA other downstream 1621836 40640175 ~ 40685641 (-)
G1548367 NA other downstream 1915594 40385970 ~ 40391883 (-)
LOC110496816 LOC106588265 other downstream 2618796 39642841 ~ 39688750 (-)
G1550177 LOC106569881 other upstream 7587 42315286 ~ 42316079 (-)
G1550202 NA other upstream 51449 42359148 ~ 42359628 (-)
LOC118936491 LOC106588302 other upstream 587332 42895031 ~ 43015119 (-)
LOC118940987 NA other upstream 1323307 43624763 ~ 43668196 (-)
G1552768 LOC106588550 other upstream 2513064 44820763 ~ 44828808 (-)

Expression


G1550170 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1550170 Expression in each Bioproject

Bar chart with 14 bars.
G1550170 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network