G1555420



Basic Information


Item Value
gene id G1555420
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 47483356 ~ 47485192 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1779588
gtctgtgatcgctcgctctctgtctgctcgctcgctctctctgtctgtgatcgctcgctctctctctctctctgtctgtgctctctctctgtctgtgctcgctcgctctctctctgtctgtgctctcgctctctctgtctgtgctcgctcgctctctctctctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctatgatcgctcgctcgctctctctgtcattgctcgctctctctgtctgtgatcgCTCGCTCTATCTGTCTGTGATCTgtctgtgatctctctctctctctcgcatgacgctctctctctctcgcattgcactctctctctcgcaaggtcctctctctctctcgcatggcactctctctctcgcaaggtcctctctctctctcgcaaggtcctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctctctctctctcgcaaggccctcgctctctctcgtggctctctctctctgtgctctctctatGTGCtcgcccactctctctctgtgctcgctcgctctctctctctctgtcgttgctcgctcgctctctctgtagttgctcgctcgctctctctgtcgttgctcgctcgctctctctgtcgttgctcgctcgctctctctgtgctcgctcgctctctctgtctgtgctcgctcgctc
>TU1779589
gtctgtgatcgctcgctctctgtctgctcgctcgctctctctgtctgtgatcgctcgctctctctctctctctgtctgtgctctctctctgtctgtgctcgctcgctcgctctctctctgtctgtgctcgcttgctctctctctctgtgctcgctcgctctctctgtctgtgctcgctcgctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtctgtgctcgctcgctctctctgtgctcgctcgctctctctgtctgtgctcgctcgctc

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1779588 False 983 TUCP 0.59 2 47483356 47485192
TU1779589 True 292 lncRNA 0.60 2 47483356 47485192

Neighbor


gene id symbol gene type direction distance location
LOC110496394 LOC106588610 coding upstream 116863 47361958 ~ 47366493 (+)
LOC110496392 nudc coding upstream 143510 47329603 ~ 47339846 (+)
LOC110496391 LOC106588613 coding upstream 162084 47317827 ~ 47321272 (+)
LOC110496390 NA coding upstream 201343 47279653 ~ 47282013 (+)
LOC118941175 NA coding upstream 210876 47270121 ~ 47272480 (+)
LOC110496396 LOC106588636 coding downstream 38598 47523790 ~ 47533373 (+)
LOC110496397 LOC106588637 coding downstream 48585 47533777 ~ 47545346 (+)
LOC110496400 LOC106588639 coding downstream 315621 47800813 ~ 47826805 (+)
LOC110496404 LOC106588645 coding downstream 588701 48073893 ~ 48109017 (+)
LOC110496405 LOC106588646 coding downstream 647118 48132310 ~ 48140645 (+)
G1555369 NA non-coding upstream 154236 47328788 ~ 47329120 (+)
G1555367 NA non-coding upstream 172691 47310436 ~ 47310665 (+)
G1555366 NA non-coding upstream 180856 47302286 ~ 47302500 (+)
G1555341 NA non-coding upstream 222118 47251337 ~ 47261238 (+)
G1555054 NA non-coding upstream 309147 47173920 ~ 47174209 (+)
G1555436 NA non-coding downstream 53123 47538315 ~ 47538642 (+)
G1555437 NA non-coding downstream 53579 47538771 ~ 47538998 (+)
G1555580 NA non-coding downstream 77058 47562250 ~ 47562495 (+)
G1555672 NA non-coding downstream 133937 47619129 ~ 47619409 (+)
G1555679 NA non-coding downstream 140859 47626051 ~ 47626280 (+)
LOC110496389 LOC106588614 other upstream 281320 47200301 ~ 47202906 (+)
G1554912 NA other upstream 566396 46911533 ~ 46916960 (+)
G1554852 LOC106588605 other upstream 660872 46822126 ~ 46822484 (+)
G1554410 NA other upstream 843247 46577330 ~ 46640109 (+)
khdrbs3 LOC106588624 other upstream 1075843 46301213 ~ 46444565 (+)
G1555433 NA other downstream 42553 47527745 ~ 47528039 (+)
G1556007 NA other downstream 415277 47900469 ~ 47901628 (+)
G1556006 LOC106588626 other downstream 417663 47902855 ~ 47903371 (+)
G1556003 LOC106588626 other downstream 418657 47903849 ~ 47905387 (+)
G1556127 NA other downstream 589444 48074636 ~ 48112652 (+)

Expression


G1555420 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1555420 Expression in each Bioproject

Bar chart with 19 bars.
G1555420 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network