G1555910



Basic Information


Item Value
gene id G1555910
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 47757501 ~ 47759406 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1780157
cacgttctgacctttatttcctttgttttgtatttatttagtatggtcagggcgtgagttgggtgggcagtctatgtttgtttttctatgttttggggcatttctatgtttcggcctagtatggttctcaatcagaggcaggtgtcattagttgtctctgattgagaatcatacttaggtagcctgggttgcactgtttgtttgtgggtgattgtctatgttgatggcttgtttcagcgcagctcgcattagcttcacggttgttattttgtttact

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1780157 True 277 lncRNA 0.42 2 47757501 47759406

Neighbor


gene id symbol gene type direction distance location
LOC110496398 LOC106588638 coding downstream 110090 47636521 ~ 47647411 (-)
LOC110496393 LOC106588612 coding downstream 429142 47326949 ~ 47328359 (-)
LOC118941176 NA coding downstream 465293 47258150 ~ 47292208 (-)
LOC118941174 NA coding downstream 506534 47248660 ~ 47250967 (-)
LOC118941173 NA coding downstream 516063 47239132 ~ 47241438 (-)
LOC110496399 NA coding upstream 47673 47807079 ~ 47808361 (-)
LOC110496837 LOC106588626 coding upstream 131174 47890580 ~ 47945574 (-)
LOC110496401 LOC106588640 coding upstream 223320 47982726 ~ 47986560 (-)
LOC110496402 LOC106588641 coding upstream 242480 48001886 ~ 48022110 (-)
LOC110496403 LOC106570256 coding upstream 278452 48037858 ~ 48049720 (-)
G1555883 NA non-coding downstream 32932 47716381 ~ 47724569 (-)
G1555868 NA non-coding downstream 35118 47692938 ~ 47722383 (-)
G1555758 NA non-coding downstream 70218 47686972 ~ 47687283 (-)
G1555731 NA non-coding downstream 86941 47670041 ~ 47670560 (-)
G1555699 NA non-coding downstream 114974 47641405 ~ 47642527 (-)
G1555912 NA non-coding upstream 1957 47761363 ~ 47761591 (-)
G1555913 NA non-coding upstream 2857 47762263 ~ 47762486 (-)
G1555914 NA non-coding upstream 3162 47762568 ~ 47762899 (-)
G1555915 NA non-coding upstream 3559 47762965 ~ 47763205 (-)
G1555922 NA non-coding upstream 17316 47776722 ~ 47777018 (-)
G1555543 NA other downstream 210930 47543208 ~ 47546614 (-)
G1555168 NA other downstream 844586 46911977 ~ 46912915 (-)
G1554091 NA other downstream 1649399 46101248 ~ 46108102 (-)
G1553693 LOC106588587 other downstream 1954453 45788099 ~ 45803048 (-)
G1553544 NA other downstream 2089761 45667361 ~ 45667740 (-)
G1556577 NA other upstream 597207 48356613 ~ 48356847 (-)
G1558535 NA other upstream 2208490 49967896 ~ 49968608 (-)
LOC110496434 LOC106588680 other upstream 2263685 50023087 ~ 50034167 (-)

Expression


G1555910 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1555910 Expression in each Bioproject

Bar chart with 20 bars.
G1555910 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network