G1558535



Basic Information


Item Value
gene id G1558535
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 49967896 ~ 49968608 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1783089
aacaaatcaaaaacggaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctgtctctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtctcgtatattgcacaaatctggcctttatggaagagtggccatttcttaaagatatccataaaaatggttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctttggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1783089 True 713 TUCP 0.42 1 49967896 49968608

Neighbor


gene id symbol gene type direction distance location
LOC110496426 LOC106588671 coding downstream 170921 49767140 ~ 49796975 (-)
LOC100135978 LOC106588669 coding downstream 494767 49332681 ~ 49473129 (-)
LOC118940996 NA coding downstream 570429 49380856 ~ 49397467 (-)
LOC110496424 LOC106588667 coding downstream 670553 49295572 ~ 49297343 (-)
LOC110496421 LOC106588664 coding downstream 758413 49203985 ~ 49209483 (-)
LOC110496431 LOC106588678 coding upstream 4846 49973454 ~ 49982570 (-)
LOC110496434 LOC106588680 coding upstream 54479 50023087 ~ 50034167 (-)
LOC110496842 LOC106588681 coding upstream 136674 50105282 ~ 50143368 (-)
rfa3 rfa3 coding upstream 179696 50148304 ~ 50149605 (-)
LOC118941183 NA coding upstream 183415 50152023 ~ 50197214 (-)
G1558460 NA non-coding downstream 45205 49921197 ~ 49922691 (-)
G1558459 NA non-coding downstream 83426 49876508 ~ 49884470 (-)
G1558254 NA non-coding downstream 120470 49847163 ~ 49847426 (-)
G1558215 NA non-coding downstream 214804 49746279 ~ 49753092 (-)
G1558196 NA non-coding downstream 263551 49690614 ~ 49704345 (-)
G1558551 NA non-coding upstream 23501 49992109 ~ 50001982 (-)
G1558557 NA non-coding upstream 37736 50006344 ~ 50006578 (-)
G1558639 NA non-coding upstream 182290 50150898 ~ 50151114 (-)
G1558649 NA non-coding upstream 189191 50157799 ~ 50158258 (-)
G1558641 LOC106588684 non-coding upstream 191079 50159687 ~ 50164221 (-)
G1556577 NA other downstream 1611049 48356613 ~ 48356847 (-)
LOC110496401 LOC106588640 other downstream 1984287 47982726 ~ 47986560 (-)
LOC110496837 LOC106588626 other downstream 2022322 47890580 ~ 47945574 (-)
G1555543 NA other downstream 2421325 47543208 ~ 47546614 (-)
G1555168 NA other downstream 3054981 46911977 ~ 46912915 (-)
LOC110496438 LOC106588686 other upstream 387661 50256021 ~ 50359132 (-)
G1558916 NA other upstream 468389 50436997 ~ 50437459 (-)
G1559205 NA other upstream 654483 50623091 ~ 50623983 (-)
thsd7aa LOC106588717 other upstream 666795 50599944 ~ 50755992 (-)

Expression


G1558535 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1558535 Expression in each Bioproject

Bar chart with 21 bars.
G1558535 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network