G1568438



Basic Information


Item Value
gene id G1568438
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 59757640 ~ 59760282 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1794519
ggtttttgtatgtggtgtgtatgtatagggattgtagctagtggggtgttctagctaagtctatggctgtctgaagtggttctcaatcagaggcaggtgtttatcgttgtctctgattgggaaccatatttaggcagccatattctttgagtttgtggtgggtgattgtccttagtgtcctgatgtcattgttctgtgttaggttacacaagtataggctgtttcggttttcgttaagtttattgttttgatagtgtttgtgtttagtgtgttacttcattaaacatggattgcaatagac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1794519 True 301 lncRNA 0.40 2 59757640 59760282

Neighbor


gene id symbol gene type direction distance location
LOC110496637 gng11 coding downstream 19047 59712624 ~ 59738593 (-)
LOC110496638 gng11 coding downstream 59476 59696846 ~ 59698164 (-)
zgc:85777 ivd coding downstream 61254 59647948 ~ 59696386 (-)
LOC110496639 NA coding downstream 78616 59673674 ~ 59679024 (-)
col1a2 col1a2 coding downstream 232626 59501168 ~ 59525014 (-)
LOC110496642 vps50 coding upstream 146624 59906906 ~ 59932090 (-)
LOC110496641 vps50 coding upstream 258352 60018634 ~ 60200664 (-)
LOC110496644 LOC106588945 coding upstream 441666 60201948 ~ 60254724 (-)
LOC110496648 NA coding upstream 612236 60372518 ~ 60374871 (-)
LOC110496650 elmo1 coding upstream 664767 60425049 ~ 60603918 (-)
G1568395 gng11 non-coding downstream 19024 59695829 ~ 59738616 (-)
G1568136 NA non-coding downstream 356717 59400053 ~ 59400923 (-)
G1568122 NA non-coding downstream 383160 59370597 ~ 59374480 (-)
G1568121 NA non-coding downstream 386533 59369575 ~ 59371107 (-)
G1568035 NA non-coding downstream 484420 59194899 ~ 59273220 (-)
G1568502 NA non-coding upstream 89347 59849629 ~ 59851133 (-)
G1568505 NA non-coding upstream 92728 59853010 ~ 59853235 (-)
G1568517 NA non-coding upstream 103656 59863938 ~ 59864236 (-)
G1568524 NA non-coding upstream 109512 59869794 ~ 59870109 (-)
G1568534 NA non-coding upstream 121168 59881450 ~ 59881671 (-)
G1568017 NA other downstream 600596 59155028 ~ 59157044 (-)
G1567931 NA other downstream 682992 59004845 ~ 59074648 (-)
G1567871 LOC106588914 other downstream 883949 58870937 ~ 58873691 (-)
G1567875 NA other downstream 887633 58869363 ~ 58870007 (-)
G1569198 NA other upstream 481649 60241931 ~ 60251369 (-)
G1569258 NA other upstream 588494 60348776 ~ 60350759 (-)
G1569277 NA other upstream 619571 60379853 ~ 60389092 (-)
LOC110496651 NA other upstream 850205 60610487 ~ 60642154 (-)
G1569439 NA other upstream 933096 60693378 ~ 60694099 (-)

Expression


G1568438 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1568438 Expression in each Bioproject

Bar chart with 12 bars.
G1568438 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network