G1579398



Basic Information


Item Value
gene id G1579398
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 71700619 ~ 71701099 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1807552
AGATGGTGCCCTTAAATACTGATCTAGGTCAGATGGTGCCCTTAAATACTGATCTAGGTCAGATGGTACCCTTAAATACTGATCTTAGGTCAGATAGTGCCCTTAAATACTGATCTAGGTCAGATGGTACCCTTAAATACTGATCTAGGTCAGATGGTGCCCTTAAATACTGATCTAGGTCAGATGGTACCCTTAAATACTGATCTAGGTCAGATGGTGCCCTTAAATACTGATCTAGGTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1807552 True 241 lncRNA 0.41 2 71700619 71701099

Neighbor


gene id symbol gene type direction distance location
LOC118940973 NA coding upstream 490976 71208388 ~ 71209643 (+)
LOC118941014 NA coding upstream 641464 71058367 ~ 71059155 (+)
LOC110515436 LOC106570762 coding upstream 747824 70857223 ~ 70952795 (+)
acot13 acot13 coding upstream 923267 70774594 ~ 70777352 (+)
LOC118941216 NA coding upstream 936945 70760086 ~ 70763674 (+)
LOC118941017 NA coding downstream 243143 71944242 ~ 71946176 (+)
LOC118941219 LOC103143335 coding downstream 1191755 72892854 ~ 72909233 (+)
yars1 yars coding downstream 1304797 73005896 ~ 73016843 (+)
sync sync coding downstream 1429700 73130799 ~ 73174920 (+)
LOC110496903 LOC106570720 coding downstream 1500700 73201799 ~ 73281251 (+)
G1579386 NA non-coding upstream 41130 71659254 ~ 71659489 (+)
G1579384 NA non-coding upstream 45969 71654447 ~ 71654650 (+)
G1579380 NA non-coding upstream 58843 71641575 ~ 71641776 (+)
G1579378 NA non-coding upstream 64588 71635829 ~ 71636031 (+)
G1579377 NA non-coding upstream 66845 71633542 ~ 71633774 (+)
G1579414 NA non-coding downstream 30908 71732007 ~ 71733128 (+)
G1579422 NA non-coding downstream 50968 71752067 ~ 71754997 (+)
G1579435 NA non-coding downstream 91712 71792811 ~ 71794904 (+)
G1579440 NA non-coding downstream 99265 71800364 ~ 71801566 (+)
G1579445 NA non-coding downstream 120468 71821567 ~ 71822020 (+)
G1578630 NA other upstream 1281346 70418859 ~ 70419273 (+)
LOC110519153 runx1t1 other upstream 1401494 70192261 ~ 70385585 (+)
G1577699 NA other upstream 1936366 69762713 ~ 69764253 (+)
G1577567 NA other upstream 2084276 69615279 ~ 69616967 (+)
si:ch211-215i13.3 LOC106589127 other upstream 2325702 69360411 ~ 69374917 (+)
G1579579 NA other downstream 437058 72138157 ~ 72138592 (+)
G1579615 NA other downstream 526232 72227331 ~ 72227659 (+)
G1579986 NA other downstream 561317 72262416 ~ 72263220 (+)
G1580222 NA other downstream 894965 72596064 ~ 72596671 (+)

Expression


G1579398 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1579398 Expression in each Bioproject

Bar chart with 3 bars.
G1579398 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network