G1579477



Basic Information


Item Value
gene id G1579477
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 71895738 ~ 71901190 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1807655
ggttagagaactgtcccctactgttcaacaggttagagaactgtcccctactgttcaacaggttagagaactgtcccctactgttaaacaggttagagaactgtcccctactgtcccctactgttaaacaggttagagaactgtcccctatagttaaacaggttagagaactgtcccctactgttaaacaggttagagaactgtcccctactgtcccctactgttaaacaggttagagaactgtcccctactgttaaacaggttagagaactgtcccctactgttaaacaggttagagaactgtcccctactg

Function


NR:

description
rho GTPase-activating protein 29-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1807655 True 313 lncRNA 0.45 2 71895738 71901190

Neighbor


gene id symbol gene type direction distance location
LOC118940973 NA coding upstream 686095 71208388 ~ 71209643 (+)
LOC118941014 NA coding upstream 836583 71058367 ~ 71059155 (+)
LOC110515436 LOC106570762 coding upstream 942943 70857223 ~ 70952795 (+)
acot13 acot13 coding upstream 1118386 70774594 ~ 70777352 (+)
LOC118941216 NA coding upstream 1132064 70760086 ~ 70763674 (+)
LOC118941017 NA coding downstream 43052 71944242 ~ 71946176 (+)
LOC118941219 LOC103143335 coding downstream 991664 72892854 ~ 72909233 (+)
yars1 yars coding downstream 1104706 73005896 ~ 73016843 (+)
sync sync coding downstream 1229609 73130799 ~ 73174920 (+)
LOC110496903 LOC106570720 coding downstream 1300609 73201799 ~ 73281251 (+)
G1579472 NA non-coding upstream 19785 71875482 ~ 71875953 (+)
G1579467 NA non-coding upstream 37377 71857597 ~ 71858361 (+)
G1579445 NA non-coding upstream 73718 71821567 ~ 71822020 (+)
G1579440 NA non-coding upstream 94172 71800364 ~ 71801566 (+)
G1579435 NA non-coding upstream 100834 71792811 ~ 71794904 (+)
G1579479 NA non-coding downstream 10186 71911376 ~ 71911611 (+)
G1579481 NA non-coding downstream 11725 71912915 ~ 71916167 (+)
G1579483 NA non-coding downstream 20137 71921327 ~ 71921558 (+)
G1579502 NA non-coding downstream 69547 71970737 ~ 71971535 (+)
G1579505 NA non-coding downstream 82682 71983872 ~ 71984145 (+)
G1578630 NA other upstream 1476465 70418859 ~ 70419273 (+)
LOC110519153 runx1t1 other upstream 1596613 70192261 ~ 70385585 (+)
G1577699 NA other upstream 2131485 69762713 ~ 69764253 (+)
G1577567 NA other upstream 2279395 69615279 ~ 69616967 (+)
si:ch211-215i13.3 LOC106589127 other upstream 2520821 69360411 ~ 69374917 (+)
G1579579 NA other downstream 236967 72138157 ~ 72138592 (+)
G1579615 NA other downstream 326141 72227331 ~ 72227659 (+)
G1579986 NA other downstream 361226 72262416 ~ 72263220 (+)
G1580222 NA other downstream 694874 72596064 ~ 72596671 (+)

Expression


G1579477 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1579477 Expression in each Bioproject

Bar chart with 5 bars.
G1579477 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network