G1579579



Basic Information


Item Value
gene id G1579579
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 72138157 ~ 72138592 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1807779
cacctagatcttctgcacagattctgtcagacctgggccctgacagtaaatctcagtaagaccaaaataatggtgttccaaaaaaggtccagtcaccaggaccacaaatacaaattccatctagacactgttgccctagagcacacaaaaaactatacatacctcggcctaaacatcagcgccacaggtaacttccacaaagctgtgaacgatctgagagacaaggcaagaagggcattctatgccatcaaaaggaacataaatttcaacataccaattaggatttggctaaaaatacttgaatcagtcatagagcccattgccctttatggttgtgaggtctggggtccgctcaccaaccaaaacttcacaaaatgggacaaacaccaaattgagacaatttatcctccgtgtacaacgtatatcctccatgtac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1807779 True 436 TUCP 0.43 1 72138157 72138592

Neighbor


gene id symbol gene type direction distance location
LOC118941017 NA coding upstream 191981 71944242 ~ 71946176 (+)
LOC118940973 NA coding upstream 928514 71208388 ~ 71209643 (+)
LOC118941014 NA coding upstream 1079002 71058367 ~ 71059155 (+)
LOC110515436 LOC106570762 coding upstream 1185362 70857223 ~ 70952795 (+)
acot13 acot13 coding upstream 1360805 70774594 ~ 70777352 (+)
LOC118941219 LOC103143335 coding downstream 754262 72892854 ~ 72909233 (+)
yars1 yars coding downstream 867304 73005896 ~ 73016843 (+)
sync sync coding downstream 992207 73130799 ~ 73174920 (+)
LOC110496903 LOC106570720 coding downstream 1063207 73201799 ~ 73281251 (+)
LOC110496759 nupl2 coding downstream 1257853 73396445 ~ 73418514 (+)
G1579578 NA non-coding upstream 1038 72136901 ~ 72137119 (+)
G1579576 NA non-coding upstream 3687 72134240 ~ 72134470 (+)
G1579574 NA non-coding upstream 10258 72127699 ~ 72127899 (+)
G1579572 NA non-coding upstream 12238 72125683 ~ 72125919 (+)
G1579565 NA non-coding upstream 25446 72111472 ~ 72112711 (+)
G1579584 NA non-coding downstream 8957 72147549 ~ 72151455 (+)
G1579590 NA non-coding downstream 16643 72155235 ~ 72155714 (+)
G1579592 NA non-coding downstream 18985 72157577 ~ 72158799 (+)
G1579593 NA non-coding downstream 20254 72158846 ~ 72159179 (+)
G1579594 NA non-coding downstream 20659 72159251 ~ 72159471 (+)
G1578630 NA other upstream 1718884 70418859 ~ 70419273 (+)
LOC110519153 runx1t1 other upstream 1839032 70192261 ~ 70385585 (+)
G1577699 NA other upstream 2373904 69762713 ~ 69764253 (+)
G1577567 NA other upstream 2521814 69615279 ~ 69616967 (+)
si:ch211-215i13.3 LOC106589127 other upstream 2763240 69360411 ~ 69374917 (+)
G1579615 NA other downstream 88739 72227331 ~ 72227659 (+)
G1579986 NA other downstream 123824 72262416 ~ 72263220 (+)
G1580222 NA other downstream 457472 72596064 ~ 72596671 (+)
G1580586 NA other downstream 1204705 73343297 ~ 73343837 (+)

Expression


G1579579 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1579579 Expression in each Bioproject

Bar chart with 20 bars.
G1579579 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network