LOC118941553



Basic Information


Item Value
gene id LOC118941553
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 12274733 ~ 12274799 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005037850.1
AATGCGTGATGACAAATTGTTTCGGCCCAATGATTGCAACTGACTACTGGTAAAGAGATCTGATGTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005037850.1 True 67 mRNA 0.40 1 12274733 12274799

Neighbor


gene id symbol gene type direction distance location
mab21l2 LOC106602368 coding upstream 198724 12074092 ~ 12076009 (+)
LOC110498649 LOC106602362 coding upstream 347514 11817950 ~ 11927219 (+)
LOC110497374 LOC106610191 coding upstream 643356 11563384 ~ 11631377 (+)
LOC110497373 tmem184c coding upstream 727061 11541421 ~ 11547672 (+)
LOC110497371 LOC106610223 coding upstream 742484 11489498 ~ 11532249 (+)
LOC118941562 NA coding downstream 1440 12276239 ~ 12276368 (+)
LOC110497380 LOC106602395 coding downstream 31001 12305800 ~ 12344209 (+)
dctpp1 xtp3a coding downstream 89286 12364085 ~ 12365542 (+)
LOC118941456 NA coding downstream 92513 12367312 ~ 12367796 (+)
LOC110497384 galntl6 coding downstream 668663 12943462 ~ 13174901 (+)
G1591047 NA non-coding upstream 2032 12272499 ~ 12272701 (+)
G1590992 NA non-coding upstream 75430 12198603 ~ 12199303 (+)
G1590921 NA non-coding upstream 210025 12064387 ~ 12064708 (+)
G1590916 NA non-coding upstream 213356 12058493 ~ 12061377 (+)
G1590905 NA non-coding upstream 234299 12039559 ~ 12040434 (+)
G1591101 NA non-coding downstream 80584 12355383 ~ 12355814 (+)
G1591456 NA non-coding downstream 178953 12453752 ~ 12453990 (+)
G1591457 NA non-coding downstream 179405 12454204 ~ 12454415 (+)
G1591480 NA non-coding downstream 214204 12489003 ~ 12489203 (+)
G1590347 NA other upstream 759611 11514656 ~ 11515122 (+)
LOC110497369 lsm6 other upstream 1047451 11225326 ~ 11227282 (+)
G1589200 NA other upstream 1687168 10587138 ~ 10587565 (+)
G1589189 NA other upstream 1705851 10562934 ~ 10568998 (+)
G1593802 NA other downstream 2398179 14672978 ~ 14673630 (+)
G1594135 NA other downstream 3021804 15296603 ~ 15296919 (+)
LOC110498496 LOC106602458 other downstream 3371692 15646177 ~ 15661620 (+)
G1594470 NA other downstream 3518217 15793016 ~ 15793593 (+)
LOC110498515 LOC106610069 other downstream 3524517 15799279 ~ 15887743 (+)

Expression


LOC118941553 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

LOC118941553 Expression in each Bioproject

Bar chart with 7 bars.
LOC118941553 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network