G1587522 (LOC106598223)



Basic Information


Item Value
gene id G1587522
gene name LOC106598223
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 8146257 ~ 8225033 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1817696
CTATCATCAACATGTCCATGGAGAACTCCACAGAGATGAAAGACATTCTACAGATTGTTGTTCATGCTTTTATCAGGATGAAGGAAGTGGGGAAGAAGCCGATATGTCATTTTGTGCACCAGAATGTGTCAGACATGTCTGCTCATGACAACAACATGAGAGACCGAAAGAAGTTGTTGGAACAGTTGAATGAAATGACCCAGGCAGCAGCCAGAATGGAGAAGAAGGAGAATATCACCAAGTTCACTGATGTGATGGATTATGATCCAGACACAAGCAGCTGCTACATCCCAGGACTCTGGCATGGGACTCCCCCTATGGCTCCAGTCAATGCTGGCTACAGTGAGGCTGTGTACAGCTTCAAGAAGA

Function


NR:

description
interferon-induced very large GTPase 1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1817696 True 369 TUCP 0.46 2 8146257 8225033
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110519453 LOC105024706 coding downstream 108143 8014499 ~ 8038114 (-)
LOC110512762 LOC108236415 coding downstream 165163 7938227 ~ 7981094 (-)
LOC110500908 LOC106592107 coding downstream 237474 7886301 ~ 7908783 (-)
LOC118941433 LOC106610372 coding downstream 273031 7773602 ~ 7873226 (-)
LOC110497203 LOC106602151 coding downstream 585824 7552715 ~ 7560433 (-)
LOC110510381 LOC106591338 coding upstream 25549 8250582 ~ 8298883 (-)
LOC110518067 LOC106597144 coding upstream 98917 8323950 ~ 8330921 (-)
LOC100136663 LOC100136663 coding upstream 147369 8372402 ~ 8384441 (-)
LOC110512765 NA coding upstream 172619 8397350 ~ 8398366 (-)
LOC110518994 LOC106577271 coding upstream 188009 8413042 ~ 8421404 (-)
G1587515 LOC106591138 non-coding downstream 18479 8081853 ~ 8127778 (-)
G1587508 LOC106596936 non-coding downstream 80594 8060425 ~ 8065663 (-)
G1587389 NA non-coding downstream 92682 8053359 ~ 8053575 (-)
G1587380 NA non-coding downstream 103832 8041336 ~ 8042425 (-)
G1587566 NA non-coding upstream 3727 8228760 ~ 8229196 (-)
G1587581 NA non-coding upstream 85848 8310881 ~ 8311235 (-)
G1587585 NA non-coding upstream 90010 8315043 ~ 8315651 (-)
G1587588 NA non-coding upstream 107857 8332890 ~ 8335564 (-)
G1587592 NA non-coding upstream 117130 8342163 ~ 8342393 (-)
G1587221 NA other downstream 372823 7773043 ~ 7773434 (-)
G1586560 NA other downstream 1266500 6879326 ~ 6879757 (-)
G1586357 NA other downstream 1600390 6545223 ~ 6545867 (-)
LOC110497340 djb14 other downstream 1965101 6170059 ~ 6181437 (-)
G1587567 NA other upstream 18525 8243558 ~ 8334878 (-)
G1588003 LOC106610497 other upstream 677822 8902855 ~ 8953676 (-)
LOC118941443 NA other upstream 742263 8965525 ~ 8971363 (-)
LOC110498432 NA other upstream 1911827 10134147 ~ 10145900 (-)
LOC110497368 LOC106610221 other upstream 2899355 11115879 ~ 11212126 (-)

Expression


G1587522(LOC106598223) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network