G1590622



Basic Information


Item Value
gene id G1590622
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 11489518 ~ 11489764 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1821400
CTTACTGGCATATCTATTACAATGGAATGAGCACTGAGGAAATGGTCAAACATTTTAGACATTGAAAACTTTTAAAGTAATATCAATTCCTACCTTCTGTGGTTTCCTTTCTCTTTACCACTCTCACTTGAACCTTATAGTCTTGCTGTGGTGTGCAGTAACTGACAGATTGTCAGTGAGCTACTTTTTTGTCCATCGGTGAGTGTTGCTACCTCTTAAATTCCCCTTCAGATTTACAAGGATGTCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1821400 True 247 lncRNA 0.38 1 11489518 11489764
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110497368 LOC106610221 coding downstream 277392 11115879 ~ 11212126 (-)
LOC110498648 hhip coding downstream 524800 10915252 ~ 10964718 (-)
LOC110497364 LOC106610217 coding downstream 592240 10879787 ~ 10897278 (-)
LOC110497363 LOC106610230 coding downstream 624535 10832619 ~ 10864983 (-)
LOC110498645 frem3 coding downstream 678069 10759730 ~ 10811449 (-)
LOC118941455 NA coding upstream 42500 11532264 ~ 11542073 (-)
LOC110497372 prmt9 coding upstream 58641 11548405 ~ 11562995 (-)
mra mra coding upstream 154793 11644557 ~ 11742079 (-)
LOC110497375 LOC106610178 coding upstream 443256 11933020 ~ 12261321 (-)
sh3d19 LOC106610182 coding upstream 787779 12277543 ~ 12301126 (-)
G1590620 NA non-coding downstream 2123 11487190 ~ 11487395 (-)
G1590613 NA non-coding downstream 14599 11474609 ~ 11474919 (-)
G1590603 NA non-coding downstream 28196 11461120 ~ 11461322 (-)
G1590277 NA non-coding downstream 57234 11431820 ~ 11432284 (-)
G1590245 NA non-coding downstream 78502 11410790 ~ 11411016 (-)
G1590626 NA non-coding upstream 2570 11492334 ~ 11492597 (-)
G1590633 NA non-coding upstream 16435 11506199 ~ 11506451 (-)
G1590640 NA non-coding upstream 27657 11517421 ~ 11517637 (-)
G1590588 LOC106610223 non-coding upstream 36925 11526689 ~ 11528570 (-)
G1590582 NA non-coding upstream 40428 11530192 ~ 11532245 (-)
G1590098 LOC106577701 other downstream 218700 11270516 ~ 11270818 (-)
LOC110498432 NA other downstream 1343949 10134147 ~ 10145900 (-)
LOC118941443 NA other downstream 2521214 8965525 ~ 8971363 (-)
G1588003 LOC106610497 other downstream 2535842 8902855 ~ 8953676 (-)
G1590583 NA other upstream 151643 11641407 ~ 11641866 (-)
G1591322 NA other upstream 762027 12251791 ~ 12252528 (-)
LOC110497387 LOC106602387 other upstream 1736405 13226169 ~ 13239221 (-)
G1593032 spcs3 other upstream 2335795 13825559 ~ 13829469 (-)

Expression


G1590622 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1590622 Expression in each Bioproject

Bar chart with 5 bars.
G1590622 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network