G1590583



Basic Information


Item Value
gene id G1590583
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 11641407 ~ 11641866 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1821361
catcatggtttgggcctgcttttcttcagcaaggacagggaatatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacccgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatatacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaaattcagtctctcgatgtgcaaaactgatagagacataccccaagcgatttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggt

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1821361 True 460 TUCP 0.43 1 11641407 11641866

Neighbor


gene id symbol gene type direction distance location
LOC110497372 prmt9 coding downstream 78412 11548405 ~ 11562995 (-)
LOC118941455 NA coding downstream 99334 11532264 ~ 11542073 (-)
LOC110497368 LOC106610221 coding downstream 429281 11115879 ~ 11212126 (-)
LOC110498648 hhip coding downstream 676689 10915252 ~ 10964718 (-)
LOC110497364 LOC106610217 coding downstream 744129 10879787 ~ 10897278 (-)
mra mra coding upstream 2691 11644557 ~ 11742079 (-)
LOC110497375 LOC106610178 coding upstream 291154 11933020 ~ 12261321 (-)
sh3d19 LOC106610182 coding upstream 635677 12277543 ~ 12301126 (-)
LOC110497381 gatb coding upstream 703072 12344938 ~ 12363994 (-)
fbxw7 fbxw7 coding upstream 884897 12526763 ~ 12624575 (-)
G1590579 NA non-coding downstream 182 11637302 ~ 11641225 (-)
G1590703 NA non-coding downstream 8598 11632497 ~ 11632809 (-)
G1590582 NA non-coding downstream 109162 11530192 ~ 11532245 (-)
G1590588 LOC106610223 non-coding downstream 112837 11526689 ~ 11528570 (-)
G1590640 NA non-coding downstream 123770 11517421 ~ 11517637 (-)
G1590706 NA non-coding upstream 11153 11653019 ~ 11653467 (-)
G1590709 NA non-coding upstream 16000 11657866 ~ 11658187 (-)
G1590712 NA non-coding upstream 22298 11664164 ~ 11664363 (-)
G1590719 NA non-coding upstream 33264 11675130 ~ 11675357 (-)
G1590721 NA non-coding upstream 35298 11677164 ~ 11677513 (-)
G1590098 LOC106577701 other downstream 370589 11270516 ~ 11270818 (-)
LOC110498432 NA other downstream 1495838 10134147 ~ 10145900 (-)
LOC118941443 NA other downstream 2673103 8965525 ~ 8971363 (-)
G1588003 LOC106610497 other downstream 2687731 8902855 ~ 8953676 (-)
G1591322 NA other upstream 609925 12251791 ~ 12252528 (-)
LOC110497387 LOC106602387 other upstream 1584303 13226169 ~ 13239221 (-)
G1593032 spcs3 other upstream 2183693 13825559 ~ 13829469 (-)
G1595424 NA other upstream 2841559 14483425 ~ 14483790 (-)

Expression


G1590583 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1590583 Expression in each Bioproject

Bar chart with 20 bars.
G1590583 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network