G1595424



Basic Information


Item Value
gene id G1595424
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 14483425 ~ 14483790 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1826921
agatggatggggccatgtatcgcgagatcttggccaacaacctccttccctcattaagagcattgaagatgggtcgtggctgggtcttccagcatgacaatgacccgaaacacacagccagggcaactaaggagtggctccataagaagcatctcaaggtcctggagtggcctagccagtctccagacctgaacccaatagaacatatttggagggagctgaaagtccgtattgcccagcgacagtcccgaaacctgaaggatctggagaaggtctttatggaggagtgggccaaaatccctgctgcagtgtgtgcaaacctggtcaagaactacaggaaacgtatgatctctgttattgcaaaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1826921 True 366 TUCP 0.51 1 14483425 14483790

Neighbor


gene id symbol gene type direction distance location
vegfc LOC106610161 coding downstream 539384 13883312 ~ 13944041 (-)
LOC110497394 LOC106610162 coding downstream 658587 13814235 ~ 13824838 (-)
LOC110497393 LOC106610164 coding downstream 728655 13672694 ~ 13754770 (-)
LOC110497392 LOC106610166 coding downstream 923903 13453299 ~ 13559522 (-)
LOC110497391 LOC106610167 coding downstream 1030903 13422278 ~ 13452522 (-)
LOC110497396 LOC106610063 coding upstream 407975 14891765 ~ 14936266 (-)
LOC110497398 xpa coding upstream 508720 14992510 ~ 14997435 (-)
LOC110498656 LOC106610071 coding upstream 519062 15002852 ~ 15016671 (-)
trnak-cuu-76 NA coding upstream 519505 15003295 ~ 15003367 (-)
LOC110497400 LOC106610113 coding upstream 549281 15033071 ~ 15067103 (-)
G1595423 NA non-coding downstream 4837 14477885 ~ 14478588 (-)
G1595421 NA non-coding downstream 7851 14475338 ~ 14475574 (-)
G1595391 NA non-coding downstream 70729 14412216 ~ 14412696 (-)
G1593629 NA non-coding downstream 119788 14362399 ~ 14363637 (-)
G1593594 NA non-coding downstream 166990 14316195 ~ 14316435 (-)
G1595428 NA non-coding upstream 5546 14489336 ~ 14489572 (-)
G1595432 NA non-coding upstream 11146 14494936 ~ 14495579 (-)
G1595433 NA non-coding upstream 12219 14496009 ~ 14498266 (-)
G1595434 NA non-coding upstream 16898 14500688 ~ 14500994 (-)
G1595438 NA non-coding upstream 22696 14506486 ~ 14506776 (-)
G1593032 spcs3 other downstream 656184 13825559 ~ 13829469 (-)
LOC110497387 LOC106602387 other downstream 1244235 13226169 ~ 13239221 (-)
G1591322 NA other downstream 2230897 12251791 ~ 12252528 (-)
LOC110497375 LOC106610178 other downstream 2279011 11933020 ~ 12261321 (-)
G1590583 NA other downstream 2841559 11641407 ~ 11641866 (-)
LOC110498659 LOC106610072 other upstream 776102 15246799 ~ 15287139 (-)
G1596136 LOC106610103 other upstream 1316463 15800253 ~ 15901185 (-)
G1596285 NA other upstream 1541137 16024927 ~ 16025915 (-)
LOC110498490 zn271 other upstream 1695800 16178232 ~ 16191766 (-)
G1596503 LOC106610088 other upstream 1919041 16402831 ~ 16403473 (-)

Expression


G1595424 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1595424 Expression in each Bioproject

Bar chart with 18 bars.
G1595424 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network