G1594955



Basic Information


Item Value
gene id G1594955
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 16765543 ~ 16773709 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1826358
tctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgttatcaagcctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgtcgtttaaagtttgccacaagccacctgggggagacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctcatcacactgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaactgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaag

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1826358 True 825 TUCP 0.44 2 16765543 16773709

Neighbor


gene id symbol gene type direction distance location
LOC110498500 LOC106602480 coding upstream 358985 16401695 ~ 16406558 (+)
LOC118941341 LOC106610088 coding upstream 364824 16396267 ~ 16400719 (+)
LOC110498467 LOC106610080 coding upstream 376341 16250632 ~ 16389202 (+)
LOC110498495 LOC106610080 coding upstream 466164 16287967 ~ 16299379 (+)
LOC110498487 zn271 coding upstream 527154 16219935 ~ 16238389 (+)
LOC118941345 LOC106602534 coding downstream 41513 16728206 ~ 16818118 (+)
LOC118941347 NA coding downstream 240527 17014236 ~ 17037820 (+)
LOC110498663 LOC106609880 coding downstream 269462 17043171 ~ 17083684 (+)
stra6l LOC106609881 coding downstream 341540 17115249 ~ 17139219 (+)
LOC118941458 LOC106602533 coding downstream 372508 17146217 ~ 17151611 (+)
G1594952 NA non-coding upstream 4410 16760738 ~ 16761133 (+)
G1594948 NA non-coding upstream 12144 16752961 ~ 16753399 (+)
G1594926 LOC106610047 non-coding upstream 44498 16719634 ~ 16721045 (+)
G1594895 NA non-coding upstream 87421 16675609 ~ 16678122 (+)
G1594757 NA non-coding upstream 171880 16587795 ~ 16593663 (+)
G1594983 NA non-coding downstream 45519 16819228 ~ 16819498 (+)
G1594985 NA non-coding downstream 46979 16820688 ~ 16821018 (+)
G1594986 NA non-coding downstream 47321 16821030 ~ 16821558 (+)
G1594988 NA non-coding downstream 49211 16822920 ~ 16823702 (+)
G1594967 LOC106610042 non-coding downstream 61021 16834730 ~ 16835672 (+)
G1594737 LOC106610136 other upstream 329176 16434453 ~ 16436367 (+)
G1594292 LOC106610101 other upstream 481340 16279290 ~ 16284203 (+)
LOC110498508 LOC106610084 other upstream 654756 16095706 ~ 16211886 (+)
pold4 pold4 other downstream 847709 17621396 ~ 17623478 (+)
G1597295 NA other downstream 1234014 18007723 ~ 18018250 (+)
G1597342 LOC106609914 other downstream 1269702 18043411 ~ 18104592 (+)
G1598786 NA other downstream 2259176 19032885 ~ 19033176 (+)
LOC110497472 LOC106609985 other downstream 2552719 19326377 ~ 19328349 (+)

Expression


G1594955 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1594955 Expression in each Bioproject

Bar chart with 21 bars.
G1594955 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network