G1596856 (LOC106613263)



Basic Information


Item Value
gene id G1596856
gene name LOC106613263
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 17242606 ~ 17243023 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1828525
catcaatgcgagctgtggcaagaaggtttgctgtgtctgtcagcgtagtgtccagagcatggaggcgctaccaggagacaggccagtacatcaggagacgtggaggaggccgtaggagggcaacaacccagcagcaggaccgctacccccgcctttgtgcaaggaggagcactgctagagccctgcaaaatgacctccagcaggccacaaatgtgcatgtgtctgctcaaacggtcagaaacagactccatgagggtggtatgaggtcccgacgtccacaggtgggggttgtgcttacagcccaacaccgtgcaggacgtttggcatttgccagagaacaccaagattggcaaattctccactggcgccctgtgctcttcacagatgaaagcaggttcacactgagcacgtgacagac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1828525 True 418 TUCP 0.56 1 17242606 17243023
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110497421 cplx1 coding downstream 55467 17175808 ~ 17187139 (-)
LOC110497419 LOC106602599 coding downstream 125861 17107788 ~ 17116745 (-)
LOC118936405 NA coding downstream 134878 17105468 ~ 17107728 (-)
LOC110497417 LOC106602598 coding downstream 146735 17087490 ~ 17095871 (-)
LOC110498489 LOC106610080 coding downstream 228265 17001904 ~ 17014341 (-)
clta LOC106609887 coding upstream 1397 17244420 ~ 17254764 (-)
LOC110497426 LOC106576595 coding upstream 46057 17289080 ~ 17305024 (-)
LOC110497427 LOC106602593 coding upstream 66391 17309414 ~ 17326408 (-)
LOC110498555 LOC106609917 coding upstream 116915 17359938 ~ 17366305 (-)
LOC110497429 LOC106609892 coding upstream 126791 17369814 ~ 17378794 (-)
G1596854 NA non-coding downstream 3842 17238258 ~ 17238764 (-)
G1596853 LOC106602595 non-coding downstream 4672 17235401 ~ 17237934 (-)
G1596793 NA non-coding downstream 90498 17151897 ~ 17152108 (-)
G1596785 NA non-coding downstream 101420 17140899 ~ 17141186 (-)
G1596784 NA non-coding downstream 101740 17140449 ~ 17140866 (-)
G1596866 NA non-coding upstream 23469 17266492 ~ 17266700 (-)
G1596872 LOC106609889 non-coding upstream 26900 17269923 ~ 17270222 (-)
G1596869 NA non-coding upstream 31445 17274468 ~ 17282043 (-)
G1596876 NA non-coding upstream 39528 17282551 ~ 17283358 (-)
G1596877 NA non-coding upstream 40419 17283442 ~ 17283748 (-)
LOC110498506 LOC106609878 other downstream 311156 16924529 ~ 16931521 (-)
LOC110498466 LOC106606466 other downstream 654439 16523595 ~ 16588239 (-)
LOC110498461 LOC106610045 other downstream 801634 15669157 ~ 16441067 (-)
G1596503 LOC106610088 other downstream 839133 16402831 ~ 16403473 (-)
LOC110498490 zn271 other downstream 1061922 16178232 ~ 16191766 (-)
G1596879 NA other upstream 43507 17286530 ~ 17288017 (-)
G1596940 NA other upstream 194641 17437664 ~ 17437878 (-)
G1596970 LOC106609899 other upstream 251646 17494669 ~ 17530745 (-)
LOC110497446 NA other upstream 372939 17615897 ~ 17623476 (-)
G1598418 NA other upstream 1520692 18763715 ~ 18764422 (-)

Expression


G1596856(LOC106613263) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1596856(LOC106613263) Expression in each Bioproject

Bar chart with 20 bars.
G1596856(LOC106613263) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network