G1596992



Basic Information


Item Value
gene id G1596992
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 17544054 ~ 17544296 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1828680
gaggcttgcaagccaaagaacaccatcccaaccgtgaagcatgggggtggcagcatcatgttgtgggggtgctttgctgcaggagggactggtgcacttcacaaaatagatggcatcatgaggatggaaaattatgtggatatattgaagcaacatctcaacacatcagtcaggaagttaaagcttggtcataaatgggtcttccaaatggacaatgagcccaagaatacttccaaagttgtg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1828680 True 243 lncRNA 0.46 1 17544054 17544296
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110497442 LOC106609865 coding downstream 6893 17533072 ~ 17537161 (-)
LOC110497441 NA coding downstream 12389 17522938 ~ 17531665 (-)
LOC110497439 LOC105022884 coding downstream 25699 17510213 ~ 17518355 (-)
LOC118941460 NA coding downstream 35591 17506457 ~ 17508463 (-)
LOC110497437 LOC106602583 coding downstream 37641 17494676 ~ 17506413 (-)
LOC110497443 LOC106609902 coding upstream 3497 17547793 ~ 17554950 (-)
LOC110498667 LOC106609920 coding upstream 35145 17579441 ~ 17600354 (-)
LOC110497445 LOC106602577 coding upstream 60776 17605072 ~ 17613102 (-)
LOC110497446 NA coding upstream 71601 17615897 ~ 17623476 (-)
LOC118941549 NA coding upstream 152060 17696356 ~ 17696542 (-)
G1596990 NA non-coding downstream 5535 17537994 ~ 17538519 (-)
G1596970 LOC106609899 non-coding downstream 13309 17494669 ~ 17530745 (-)
LOC110497438 kdm2a non-coding downstream 66031 17475203 ~ 17494526 (-)
G1596964 NA non-coding downstream 70288 17473164 ~ 17473766 (-)
G1596939 NA non-coding downstream 106559 17437259 ~ 17437495 (-)
G1597068 NA non-coding upstream 13886 17558182 ~ 17558424 (-)
G1597077 NA non-coding upstream 28075 17572371 ~ 17572669 (-)
G1597080 NA non-coding upstream 28493 17572789 ~ 17573316 (-)
G1596940 NA other downstream 106176 17437664 ~ 17437878 (-)
G1596879 NA other downstream 256037 17286530 ~ 17288017 (-)
G1596856 LOC106613263 other downstream 301031 17242606 ~ 17243023 (-)
LOC110498506 LOC106609878 other downstream 612604 16924529 ~ 16931521 (-)
G1598418 NA other upstream 1219419 18763715 ~ 18764422 (-)
G1599097 LOC106609944 other upstream 1664996 19209292 ~ 19209964 (-)
G1599197 NA other upstream 1828013 19372309 ~ 19381751 (-)
G1599717 NA other upstream 2011301 19555597 ~ 19557357 (-)

Expression


G1596992 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1596992 Expression in each Bioproject

Bar chart with 21 bars.
G1596992 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network