G1597068



Basic Information


Item Value
gene id G1597068
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 17558182 ~ 17558424 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1828758
ctttcctgcaggagggactggtgcatttcacaaatagatggcatcatgaggctggaaaattatgtggatatattgaagcaacatctcaagacattagtcaggaagttaaagcttggttgtaaatgggtcttccaaatggccaagcatacttccaaagttgtggcaaaatggcttaaggacaacaaagtcaagatattggactggccatcacaaagccctgacctcaatcctatagaaattgtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1828758 True 243 lncRNA 0.42 1 17558182 17558424
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110497443 LOC106609902 coding downstream 3232 17547793 ~ 17554950 (-)
LOC110497442 LOC106609865 coding downstream 21021 17533072 ~ 17537161 (-)
LOC110497441 NA coding downstream 26517 17522938 ~ 17531665 (-)
LOC110497439 LOC105022884 coding downstream 39827 17510213 ~ 17518355 (-)
LOC118941460 NA coding downstream 49719 17506457 ~ 17508463 (-)
LOC110498667 LOC106609920 coding upstream 21017 17579441 ~ 17600354 (-)
LOC110497445 LOC106602577 coding upstream 46648 17605072 ~ 17613102 (-)
LOC110497446 NA coding upstream 57473 17615897 ~ 17623476 (-)
LOC118941549 NA coding upstream 137932 17696356 ~ 17696542 (-)
zdhhc5a LOC106609866 coding upstream 191800 17750224 ~ 17791565 (-)
G1596992 NA non-coding downstream 13886 17544054 ~ 17544296 (-)
G1596990 NA non-coding downstream 19663 17537994 ~ 17538519 (-)
G1596970 LOC106609899 non-coding downstream 27437 17494669 ~ 17530745 (-)
LOC110497438 kdm2a non-coding downstream 80159 17475203 ~ 17494526 (-)
G1597077 NA non-coding upstream 13947 17572371 ~ 17572669 (-)
G1597080 NA non-coding upstream 14365 17572789 ~ 17573316 (-)
G1597137 NA non-coding upstream 128126 17686550 ~ 17686840 (-)
G1597144 NA non-coding upstream 134804 17693228 ~ 17693793 (-)
G1596940 NA other downstream 120304 17437664 ~ 17437878 (-)
G1596879 NA other downstream 270165 17286530 ~ 17288017 (-)
G1596856 LOC106613263 other downstream 315159 17242606 ~ 17243023 (-)
LOC110498506 LOC106609878 other downstream 626732 16924529 ~ 16931521 (-)
G1598418 NA other upstream 1205291 18763715 ~ 18764422 (-)
G1599097 LOC106609944 other upstream 1650868 19209292 ~ 19209964 (-)
G1599197 NA other upstream 1813885 19372309 ~ 19381751 (-)
G1599717 NA other upstream 1997173 19555597 ~ 19557357 (-)

Expression


G1597068 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1597068 Expression in each Bioproject

Bar chart with 15 bars.
G1597068 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network